Incidental Mutation 'R7271:Gtf2ird1'
ID565289
Institutional Source Beutler Lab
Gene Symbol Gtf2ird1
Ensembl Gene ENSMUSG00000023079
Gene Namegeneral transcription factor II I repeat domain-containing 1
Synonymsbinding factor for early enhancer, MusTRD1, GTF3, WBSCR11, Tg(Alb1-Myc)166.8Sst, ESTM9, c-myc line 166.8, Alb/c-myc line 166.8, Alb-c-myc line 166.8, Cream1, BEN
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.623) question?
Stock #R7271 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location134357656-134456716 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 134404904 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 223 (L223P)
Ref Sequence ENSEMBL: ENSMUSP00000098217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073161] [ENSMUST00000074114] [ENSMUST00000100650] [ENSMUST00000100652] [ENSMUST00000100654] [ENSMUST00000111244] [ENSMUST00000111245] [ENSMUST00000167084] [ENSMUST00000171794] [ENSMUST00000200944] [ENSMUST00000202280] [ENSMUST00000202554]
Predicted Effect probably benign
Transcript: ENSMUST00000073161
AA Change: L223P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000072904
Gene: ENSMUSG00000023079
AA Change: L223P

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.5e-29 PFAM
Pfam:GTF2I 351 426 4.9e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1.1e-34 PFAM
Pfam:GTF2I 690 765 3.1e-34 PFAM
Pfam:GTF2I 814 889 1.7e-34 PFAM
Pfam:GTF2I 917 992 1.7e-34 PFAM
low complexity region 1020 1043 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074114
AA Change: L223P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000073752
Gene: ENSMUSG00000023079
AA Change: L223P

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.4e-29 PFAM
Pfam:GTF2I 351 426 4.5e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1.1e-34 PFAM
Pfam:GTF2I 690 765 2.8e-34 PFAM
Pfam:GTF2I 814 889 1.6e-34 PFAM
low complexity region 917 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100650
AA Change: L223P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000098215
Gene: ENSMUSG00000023079
AA Change: L223P

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.5e-29 PFAM
Pfam:GTF2I 351 426 4.9e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1.2e-34 PFAM
Pfam:GTF2I 690 765 3.1e-34 PFAM
Pfam:GTF2I 787 862 1.8e-34 PFAM
Pfam:GTF2I 890 965 1.8e-34 PFAM
low complexity region 993 1016 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100652
AA Change: L223P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000098217
Gene: ENSMUSG00000023079
AA Change: L223P

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 5.8e-29 PFAM
Pfam:GTF2I 351 425 6.6e-32 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 2.3e-34 PFAM
Pfam:GTF2I 690 764 3.3e-32 PFAM
Pfam:GTF2I 814 888 3e-33 PFAM
Pfam:GTF2I 917 991 3e-33 PFAM
low complexity region 1020 1043 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100654
AA Change: L223P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000098219
Gene: ENSMUSG00000023079
AA Change: L223P

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.3e-29 PFAM
Pfam:GTF2I 351 426 4.3e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1e-34 PFAM
Pfam:GTF2I 716 791 1.5e-34 PFAM
Pfam:GTF2I 819 894 1.5e-34 PFAM
low complexity region 922 945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111244
AA Change: L223P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106875
Gene: ENSMUSG00000023079
AA Change: L223P

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 4.3e-29 PFAM
Pfam:GTF2I 351 425 4.9e-32 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 1.7e-34 PFAM
Pfam:GTF2I 690 764 2.5e-32 PFAM
Pfam:GTF2I 787 861 2.3e-33 PFAM
Pfam:GTF2I 890 964 2.3e-33 PFAM
low complexity region 993 1016 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111245
AA Change: L223P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000106876
Gene: ENSMUSG00000023079
AA Change: L223P

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.4e-29 PFAM
Pfam:GTF2I 351 426 4.6e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1.1e-34 PFAM
Pfam:GTF2I 671 746 2.9e-34 PFAM
Pfam:GTF2I 768 843 1.7e-34 PFAM
Pfam:GTF2I 871 946 1.7e-34 PFAM
low complexity region 974 997 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167084
AA Change: L223P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000132882
Gene: ENSMUSG00000023079
AA Change: L223P

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.3e-29 PFAM
Pfam:GTF2I 351 426 4.3e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1e-34 PFAM
Pfam:GTF2I 690 765 2.7e-34 PFAM
Pfam:GTF2I 814 889 1.5e-34 PFAM
low complexity region 917 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171794
AA Change: L223P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000129392
Gene: ENSMUSG00000023079
AA Change: L223P

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.2e-29 PFAM
Pfam:GTF2I 351 426 3.8e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 8.9e-35 PFAM
Pfam:GTF2I 690 765 2.4e-34 PFAM
Pfam:GTF2I 787 862 1.4e-34 PFAM
Pfam:GTF2I 890 965 1.4e-34 PFAM
low complexity region 993 1016 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200944
AA Change: L223P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000143848
Gene: ENSMUSG00000023079
AA Change: L223P

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 4.9e-29 PFAM
Pfam:GTF2I 351 425 5.6e-32 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 2e-34 PFAM
Pfam:GTF2I 690 764 2.8e-32 PFAM
Pfam:GTF2I 814 888 2.6e-33 PFAM
low complexity region 917 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201704
Predicted Effect possibly damaging
Transcript: ENSMUST00000202280
AA Change: L223P

PolyPhen 2 Score 0.681 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000143897
Gene: ENSMUSG00000023079
AA Change: L223P

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 2.6e-26 PFAM
Pfam:GTF2I 351 425 2.9e-29 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 1e-31 PFAM
Pfam:GTF2I 690 764 1.5e-29 PFAM
Pfam:GTF2I 787 861 1.3e-30 PFAM
low complexity region 890 913 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202554
AA Change: L223P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000143809
Gene: ENSMUSG00000023079
AA Change: L223P

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 5.5e-29 PFAM
Pfam:GTF2I 351 425 6.3e-32 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 2.2e-34 PFAM
Pfam:GTF2I 671 745 3.2e-32 PFAM
Pfam:GTF2I 768 842 2.9e-33 PFAM
Pfam:GTF2I 871 945 2.9e-33 PFAM
low complexity region 974 997 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains five GTF2I-like repeats and each repeat possesses a potential helix-loop-helix (HLH) motif. It may have the ability to interact with other HLH-proteins and function as a transcription factor or as a positive transcriptional regulator under the control of Retinoblastoma protein. This gene plays a role in craniofacial and cognitive development and mutations have been associated with Williams-Beuren syndrome, a multisystem developmental disorder caused by deletion of multiple genes at 7q11.23. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygotes for one null allele is embryonic lethal with abnormal yolk sac vasulogenesis, abnormal angiogenesis, and neural tube defect. Other null allele homozygous mice are viable and have behavioral defects and exhibit a mild craniofacial defect withvariable penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik T A 2: 118,760,683 probably null Het
Afg1l C T 10: 42,415,548 probably null Het
Ahnak2 A T 12: 112,780,802 V70E Het
Alpk3 A G 7: 81,078,454 E444G possibly damaging Het
Amer2 T A 14: 60,379,674 D439E possibly damaging Het
Ano6 A G 15: 95,913,900 Y222C probably damaging Het
Atp4a A C 7: 30,722,519 K827Q probably benign Het
Atp9a G A 2: 168,734,127 Het
Casp7 T A 19: 56,436,361 C171S probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cdkl1 A G 12: 69,748,811 L315S probably benign Het
Crybg1 G T 10: 43,997,623 S1163* probably null Het
Csmd1 A T 8: 17,027,279 W121R probably damaging Het
Cyyr1 A T 16: 85,465,605 M88K possibly damaging Het
Dlc1 T C 8: 36,582,800 Q587R probably damaging Het
Dock2 T C 11: 34,273,750 E1128G possibly damaging Het
Dynap T A 18: 70,241,249 T69S possibly damaging Het
Esr1 T C 10: 4,783,874 C225R probably damaging Het
Fbxo31 C T 8: 121,578,764 probably benign Het
Fndc11 G A 2: 181,222,100 V233I possibly damaging Het
Fto T C 8: 91,485,190 F381S probably damaging Het
Gm10471 G A 5: 26,087,995 T67I probably benign Het
Ifi214 A T 1: 173,529,476 H20Q probably damaging Het
Impa2 T A 18: 67,306,736 I101N probably damaging Het
Kidins220 A T 12: 25,011,571 T854S probably benign Het
Lamb1 T A 12: 31,287,424 C385S probably damaging Het
Lrrc8c A G 5: 105,607,987 S543G probably benign Het
Maats1 A G 16: 38,328,346 I240T probably damaging Het
Manba A T 3: 135,542,376 Y342F probably damaging Het
Map3k1 T C 13: 111,756,697 D758G probably benign Het
Mtor G T 4: 148,546,485 A2300S possibly damaging Het
Musk T A 4: 58,373,409 M793K probably damaging Het
Nup133 A C 8: 123,922,414 I563S probably benign Het
Olfr1117-ps1 T A 2: 87,284,381 N30K probably benign Het
Olfr1283 A G 2: 111,369,348 T239A probably damaging Het
Olfr479 G A 7: 108,055,216 R78Q probably damaging Het
Olfr935 A T 9: 38,994,657 Y259* probably null Het
Pcdh12 C A 18: 38,283,047 V342F probably damaging Het
Pcdhb4 T A 18: 37,308,169 H177Q possibly damaging Het
Pcnx2 G A 8: 125,886,951 A587V probably benign Het
Phkb C T 8: 86,043,789 P896S probably damaging Het
Prss36 A G 7: 127,944,705 S165P probably benign Het
Prss43 A G 9: 110,828,603 D190G probably damaging Het
Psmd14 T C 2: 61,761,012 V53A probably damaging Het
Sel1l3 T G 5: 53,116,362 H1054P probably damaging Het
Selenoh T C 2: 84,670,287 R70G probably damaging Het
Serpinb9d A G 13: 33,194,634 Q21R probably benign Het
Slc29a1 T C 17: 45,588,362 E262G probably benign Het
Slc7a14 A G 3: 31,224,235 L407P probably damaging Het
Smyd4 T C 11: 75,390,499 V266A possibly damaging Het
Spata31d1a T A 13: 59,702,099 R738S probably benign Het
Srcin1 C T 11: 97,551,889 G38S probably damaging Het
Stab2 A T 10: 87,003,108 probably null Het
Syde2 A G 3: 146,020,276 N1308D possibly damaging Het
Trip11 A T 12: 101,884,352 M1151K probably damaging Het
Ttll4 A T 1: 74,688,661 I861F possibly damaging Het
Zfp319 G A 8: 95,331,843 probably benign Het
Zfp518b T C 5: 38,674,564 N33D probably benign Het
Zfp874a T A 13: 67,443,296 I90F probably benign Het
Zmiz2 G T 11: 6,399,593 V412L probably damaging Het
Other mutations in Gtf2ird1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00558:Gtf2ird1 APN 5 134358891 missense probably benign 0.03
IGL02477:Gtf2ird1 APN 5 134379978 missense probably damaging 1.00
IGL02659:Gtf2ird1 APN 5 134377041 missense probably damaging 1.00
IGL02752:Gtf2ird1 APN 5 134358824 makesense probably null
IGL02963:Gtf2ird1 APN 5 134389687 missense probably benign 0.05
IGL03328:Gtf2ird1 APN 5 134389129 critical splice donor site probably null
IGL03379:Gtf2ird1 APN 5 134382538 missense possibly damaging 0.94
R0585:Gtf2ird1 UTSW 5 134376942 missense probably damaging 1.00
R1199:Gtf2ird1 UTSW 5 134411064 missense possibly damaging 0.85
R1388:Gtf2ird1 UTSW 5 134395710 missense probably damaging 1.00
R1470:Gtf2ird1 UTSW 5 134395802 critical splice acceptor site probably null
R1470:Gtf2ird1 UTSW 5 134395802 critical splice acceptor site probably null
R1544:Gtf2ird1 UTSW 5 134358918 missense possibly damaging 0.93
R1652:Gtf2ird1 UTSW 5 134395713 missense probably damaging 1.00
R1792:Gtf2ird1 UTSW 5 134366936 intron probably null
R1852:Gtf2ird1 UTSW 5 134382580 unclassified probably null
R1938:Gtf2ird1 UTSW 5 134415245 missense probably damaging 1.00
R1996:Gtf2ird1 UTSW 5 134376886 splice site probably benign
R2020:Gtf2ird1 UTSW 5 134417093 missense probably damaging 1.00
R2025:Gtf2ird1 UTSW 5 134363934 missense probably damaging 1.00
R2849:Gtf2ird1 UTSW 5 134359007 missense probably damaging 1.00
R2964:Gtf2ird1 UTSW 5 134357684 unclassified probably null
R3421:Gtf2ird1 UTSW 5 134388500 missense probably benign 0.41
R4543:Gtf2ird1 UTSW 5 134363900 critical splice donor site probably null
R4569:Gtf2ird1 UTSW 5 134411003 missense probably damaging 1.00
R4664:Gtf2ird1 UTSW 5 134383902 missense probably damaging 1.00
R4665:Gtf2ird1 UTSW 5 134383902 missense probably damaging 1.00
R4666:Gtf2ird1 UTSW 5 134383902 missense probably damaging 1.00
R4680:Gtf2ird1 UTSW 5 134357881 missense probably damaging 1.00
R4709:Gtf2ird1 UTSW 5 134404734 missense probably benign
R4806:Gtf2ird1 UTSW 5 134383896 missense probably damaging 0.99
R4823:Gtf2ird1 UTSW 5 134395722 missense probably damaging 1.00
R4857:Gtf2ird1 UTSW 5 134362544 missense probably damaging 0.96
R4970:Gtf2ird1 UTSW 5 134402184 missense probably damaging 1.00
R4974:Gtf2ird1 UTSW 5 134357831 nonsense probably null
R4975:Gtf2ird1 UTSW 5 134395627 missense probably damaging 1.00
R5072:Gtf2ird1 UTSW 5 134390933 splice site probably null
R5112:Gtf2ird1 UTSW 5 134402184 missense probably damaging 1.00
R5653:Gtf2ird1 UTSW 5 134410967 missense probably damaging 1.00
R5681:Gtf2ird1 UTSW 5 134363318 missense probably damaging 1.00
R5738:Gtf2ird1 UTSW 5 134383818 missense probably damaging 1.00
R5753:Gtf2ird1 UTSW 5 134410983 missense probably damaging 1.00
R6385:Gtf2ird1 UTSW 5 134404690 missense probably benign 0.19
R6580:Gtf2ird1 UTSW 5 134361039 missense probably damaging 1.00
R6787:Gtf2ird1 UTSW 5 134363912 missense probably damaging 0.99
R6981:Gtf2ird1 UTSW 5 134383922 splice site probably benign
R7208:Gtf2ird1 UTSW 5 134411094 missense probably benign 0.35
R7517:Gtf2ird1 UTSW 5 134362525 missense probably benign
X0026:Gtf2ird1 UTSW 5 134376102 splice site probably null
Predicted Primers PCR Primer
(F):5'- AAATCTTGGGTGCTGGGGAC -3'
(R):5'- CTGTAGTAGCCCAGGTCTGTTATATTC -3'

Sequencing Primer
(F):5'- ACATGGGGCTCAGGCAC -3'
(R):5'- GCCCAGGTCTGTTATATTCTATAGAG -3'
Posted On2019-06-26