Incidental Mutation 'R5753:Gtf2ird1'
ID444887
Institutional Source Beutler Lab
Gene Symbol Gtf2ird1
Ensembl Gene ENSMUSG00000023079
Gene Namegeneral transcription factor II I repeat domain-containing 1
Synonymsbinding factor for early enhancer, MusTRD1, GTF3, WBSCR11, Tg(Alb1-Myc)166.8Sst, ESTM9, c-myc line 166.8, Alb/c-myc line 166.8, Alb-c-myc line 166.8, Cream1, BEN
MMRRC Submission 043358-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.695) question?
Stock #R5753 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location134357656-134456716 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 134410983 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 131 (M131T)
Ref Sequence ENSEMBL: ENSMUSP00000129392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073161] [ENSMUST00000074114] [ENSMUST00000100650] [ENSMUST00000100652] [ENSMUST00000100654] [ENSMUST00000111244] [ENSMUST00000111245] [ENSMUST00000167084] [ENSMUST00000171794] [ENSMUST00000200944] [ENSMUST00000201647] [ENSMUST00000202280] [ENSMUST00000202554]
Predicted Effect probably damaging
Transcript: ENSMUST00000073161
AA Change: M131T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000072904
Gene: ENSMUSG00000023079
AA Change: M131T

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.5e-29 PFAM
Pfam:GTF2I 351 426 4.9e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1.1e-34 PFAM
Pfam:GTF2I 690 765 3.1e-34 PFAM
Pfam:GTF2I 814 889 1.7e-34 PFAM
Pfam:GTF2I 917 992 1.7e-34 PFAM
low complexity region 1020 1043 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000074114
AA Change: M131T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000073752
Gene: ENSMUSG00000023079
AA Change: M131T

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.4e-29 PFAM
Pfam:GTF2I 351 426 4.5e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1.1e-34 PFAM
Pfam:GTF2I 690 765 2.8e-34 PFAM
Pfam:GTF2I 814 889 1.6e-34 PFAM
low complexity region 917 940 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100650
AA Change: M131T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000098215
Gene: ENSMUSG00000023079
AA Change: M131T

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.5e-29 PFAM
Pfam:GTF2I 351 426 4.9e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1.2e-34 PFAM
Pfam:GTF2I 690 765 3.1e-34 PFAM
Pfam:GTF2I 787 862 1.8e-34 PFAM
Pfam:GTF2I 890 965 1.8e-34 PFAM
low complexity region 993 1016 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100652
AA Change: M131T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000098217
Gene: ENSMUSG00000023079
AA Change: M131T

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 5.8e-29 PFAM
Pfam:GTF2I 351 425 6.6e-32 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 2.3e-34 PFAM
Pfam:GTF2I 690 764 3.3e-32 PFAM
Pfam:GTF2I 814 888 3e-33 PFAM
Pfam:GTF2I 917 991 3e-33 PFAM
low complexity region 1020 1043 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100654
AA Change: M131T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000098219
Gene: ENSMUSG00000023079
AA Change: M131T

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.3e-29 PFAM
Pfam:GTF2I 351 426 4.3e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1e-34 PFAM
Pfam:GTF2I 716 791 1.5e-34 PFAM
Pfam:GTF2I 819 894 1.5e-34 PFAM
low complexity region 922 945 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111244
AA Change: M131T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106875
Gene: ENSMUSG00000023079
AA Change: M131T

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 4.3e-29 PFAM
Pfam:GTF2I 351 425 4.9e-32 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 1.7e-34 PFAM
Pfam:GTF2I 690 764 2.5e-32 PFAM
Pfam:GTF2I 787 861 2.3e-33 PFAM
Pfam:GTF2I 890 964 2.3e-33 PFAM
low complexity region 993 1016 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111245
AA Change: M131T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106876
Gene: ENSMUSG00000023079
AA Change: M131T

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.4e-29 PFAM
Pfam:GTF2I 351 426 4.6e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1.1e-34 PFAM
Pfam:GTF2I 671 746 2.9e-34 PFAM
Pfam:GTF2I 768 843 1.7e-34 PFAM
Pfam:GTF2I 871 946 1.7e-34 PFAM
low complexity region 974 997 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167084
AA Change: M131T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132882
Gene: ENSMUSG00000023079
AA Change: M131T

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.3e-29 PFAM
Pfam:GTF2I 351 426 4.3e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1e-34 PFAM
Pfam:GTF2I 690 765 2.7e-34 PFAM
Pfam:GTF2I 814 889 1.5e-34 PFAM
low complexity region 917 940 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171794
AA Change: M131T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129392
Gene: ENSMUSG00000023079
AA Change: M131T

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.2e-29 PFAM
Pfam:GTF2I 351 426 3.8e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 8.9e-35 PFAM
Pfam:GTF2I 690 765 2.4e-34 PFAM
Pfam:GTF2I 787 862 1.4e-34 PFAM
Pfam:GTF2I 890 965 1.4e-34 PFAM
low complexity region 993 1016 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200944
AA Change: M131T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143848
Gene: ENSMUSG00000023079
AA Change: M131T

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 4.9e-29 PFAM
Pfam:GTF2I 351 425 5.6e-32 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 2e-34 PFAM
Pfam:GTF2I 690 764 2.8e-32 PFAM
Pfam:GTF2I 814 888 2.6e-33 PFAM
low complexity region 917 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201647
Predicted Effect unknown
Transcript: ENSMUST00000201704
AA Change: M83T
Predicted Effect possibly damaging
Transcript: ENSMUST00000202280
AA Change: M131T

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000143897
Gene: ENSMUSG00000023079
AA Change: M131T

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 2.6e-26 PFAM
Pfam:GTF2I 351 425 2.9e-29 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 1e-31 PFAM
Pfam:GTF2I 690 764 1.5e-29 PFAM
Pfam:GTF2I 787 861 1.3e-30 PFAM
low complexity region 890 913 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202414
Predicted Effect probably damaging
Transcript: ENSMUST00000202554
AA Change: M131T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143809
Gene: ENSMUSG00000023079
AA Change: M131T

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 5.5e-29 PFAM
Pfam:GTF2I 351 425 6.3e-32 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 2.2e-34 PFAM
Pfam:GTF2I 671 745 3.2e-32 PFAM
Pfam:GTF2I 768 842 2.9e-33 PFAM
Pfam:GTF2I 871 945 2.9e-33 PFAM
low complexity region 974 997 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202763
Meta Mutation Damage Score 0.174 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains five GTF2I-like repeats and each repeat possesses a potential helix-loop-helix (HLH) motif. It may have the ability to interact with other HLH-proteins and function as a transcription factor or as a positive transcriptional regulator under the control of Retinoblastoma protein. This gene plays a role in craniofacial and cognitive development and mutations have been associated with Williams-Beuren syndrome, a multisystem developmental disorder caused by deletion of multiple genes at 7q11.23. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygotes for one null allele is embryonic lethal with abnormal yolk sac vasulogenesis, abnormal angiogenesis, and neural tube defect. Other null allele homozygous mice are viable and have behavioral defects and exhibit a mild craniofacial defect withvariable penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik C T 5: 87,972,515 T377I probably damaging Het
Abcb1a A G 5: 8,723,160 D796G probably damaging Het
Actn3 T C 19: 4,864,567 probably null Het
Ada A T 2: 163,735,398 S57T probably benign Het
Adamts6 A G 13: 104,347,350 Y359C probably damaging Het
Adcy1 A T 11: 7,130,300 I348F probably damaging Het
Ankrd11 T C 8: 122,895,304 E603G possibly damaging Het
Bcas3 A G 11: 85,822,084 probably benign Het
Cldn1 C A 16: 26,363,121 V113L probably benign Het
Dock9 T C 14: 121,634,625 T540A probably benign Het
Erp27 A G 6: 136,919,877 F109S probably damaging Het
F13a1 G A 13: 36,898,108 Q541* probably null Het
Fam124a T C 14: 62,606,539 S499P probably benign Het
Fgd3 T A 13: 49,274,940 E486V possibly damaging Het
Flnc T C 6: 29,433,489 S11P probably benign Het
Gm12508 C A 4: 55,254,787 noncoding transcript Het
Grk2 C T 19: 4,290,468 R295H probably damaging Het
Hist1h4d G A 13: 23,581,604 M1I probably null Het
Itpripl2 A G 7: 118,491,009 V109A probably damaging Het
Jakmip2 T C 18: 43,559,116 E585G probably damaging Het
Kbtbd3 A T 9: 4,331,404 I593F possibly damaging Het
Lgr4 C T 2: 110,002,512 Q316* probably null Het
Mcf2l T C 8: 12,999,993 F305S probably damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Olfr1143 A T 2: 87,803,252 M288L probably benign Het
Olfr1264 T C 2: 90,021,503 T188A possibly damaging Het
Olfr1301 T A 2: 111,754,801 I184K possibly damaging Het
Olfr19 A T 16: 16,673,620 Y120* probably null Het
Olfr64 A G 7: 103,893,201 L178P probably damaging Het
Olfr73 G A 2: 88,034,576 L188F probably damaging Het
Olfr735 T A 14: 50,345,588 T285S probably damaging Het
Pcdh9 T A 14: 93,888,161 D191V probably damaging Het
Pde4d T A 13: 109,772,722 probably benign Het
Phkb C T 8: 85,878,230 A88V probably damaging Het
Plec A G 15: 76,173,420 S4128P probably damaging Het
Plekha5 A T 6: 140,537,004 probably null Het
Rgs13 A C 1: 144,140,740 N88K probably benign Het
Rho T A 6: 115,935,487 I104N probably damaging Het
Rnps1 T C 17: 24,418,164 probably benign Het
Slc10a7 G T 8: 78,525,299 probably null Het
Slc39a7 C T 17: 34,030,176 R246K probably damaging Het
Sort1 G C 3: 108,345,774 G510A probably damaging Het
Spag6l A G 16: 16,766,967 probably null Het
Sync T A 4: 129,293,386 Y70* probably null Het
Tex45 A T 8: 3,484,112 I350L probably benign Het
Timm8a2 T C 14: 122,034,877 V64A probably benign Het
Tnfrsf11b C A 15: 54,254,059 V267L possibly damaging Het
Trim30b A G 7: 104,357,337 V104A possibly damaging Het
Tusc3 T C 8: 39,096,946 S244P probably damaging Het
Usp16 T A 16: 87,482,899 Y746N probably damaging Het
Vax1 G T 19: 59,166,382 H274Q probably benign Het
Vmn2r108 A G 17: 20,462,917 V675A probably damaging Het
Vmn2r12 A T 5: 109,091,804 W298R probably damaging Het
Zfp948 A G 17: 21,586,894 N116S probably damaging Het
Zkscan2 A G 7: 123,480,700 V678A probably benign Het
Other mutations in Gtf2ird1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00558:Gtf2ird1 APN 5 134358891 missense probably benign 0.03
IGL02477:Gtf2ird1 APN 5 134379978 missense probably damaging 1.00
IGL02659:Gtf2ird1 APN 5 134377041 missense probably damaging 1.00
IGL02752:Gtf2ird1 APN 5 134358824 makesense probably null
IGL02963:Gtf2ird1 APN 5 134389687 missense probably benign 0.05
IGL03328:Gtf2ird1 APN 5 134389129 critical splice donor site probably null
IGL03379:Gtf2ird1 APN 5 134382538 missense possibly damaging 0.94
R0585:Gtf2ird1 UTSW 5 134376942 missense probably damaging 1.00
R1199:Gtf2ird1 UTSW 5 134411064 missense possibly damaging 0.85
R1388:Gtf2ird1 UTSW 5 134395710 missense probably damaging 1.00
R1470:Gtf2ird1 UTSW 5 134395802 critical splice acceptor site probably null
R1470:Gtf2ird1 UTSW 5 134395802 critical splice acceptor site probably null
R1544:Gtf2ird1 UTSW 5 134358918 missense possibly damaging 0.93
R1652:Gtf2ird1 UTSW 5 134395713 missense probably damaging 1.00
R1792:Gtf2ird1 UTSW 5 134366936 intron probably null
R1852:Gtf2ird1 UTSW 5 134382580 unclassified probably null
R1938:Gtf2ird1 UTSW 5 134415245 missense probably damaging 1.00
R1996:Gtf2ird1 UTSW 5 134376886 splice site probably benign
R2020:Gtf2ird1 UTSW 5 134417093 missense probably damaging 1.00
R2025:Gtf2ird1 UTSW 5 134363934 missense probably damaging 1.00
R2849:Gtf2ird1 UTSW 5 134359007 missense probably damaging 1.00
R2964:Gtf2ird1 UTSW 5 134357684 unclassified probably null
R3421:Gtf2ird1 UTSW 5 134388500 missense probably benign 0.41
R4543:Gtf2ird1 UTSW 5 134363900 critical splice donor site probably null
R4569:Gtf2ird1 UTSW 5 134411003 missense probably damaging 1.00
R4664:Gtf2ird1 UTSW 5 134383902 missense probably damaging 1.00
R4665:Gtf2ird1 UTSW 5 134383902 missense probably damaging 1.00
R4666:Gtf2ird1 UTSW 5 134383902 missense probably damaging 1.00
R4680:Gtf2ird1 UTSW 5 134357881 missense probably damaging 1.00
R4709:Gtf2ird1 UTSW 5 134404734 missense probably benign
R4806:Gtf2ird1 UTSW 5 134383896 missense probably damaging 0.99
R4823:Gtf2ird1 UTSW 5 134395722 missense probably damaging 1.00
R4857:Gtf2ird1 UTSW 5 134362544 missense probably damaging 0.96
R4970:Gtf2ird1 UTSW 5 134402184 missense probably damaging 1.00
R4974:Gtf2ird1 UTSW 5 134357831 nonsense probably null
R4975:Gtf2ird1 UTSW 5 134395627 missense probably damaging 1.00
R5072:Gtf2ird1 UTSW 5 134390933 splice site probably null
R5112:Gtf2ird1 UTSW 5 134402184 missense probably damaging 1.00
R5653:Gtf2ird1 UTSW 5 134410967 missense probably damaging 1.00
R5681:Gtf2ird1 UTSW 5 134363318 missense probably damaging 1.00
R5738:Gtf2ird1 UTSW 5 134383818 missense probably damaging 1.00
R6385:Gtf2ird1 UTSW 5 134404690 missense probably benign 0.19
R6580:Gtf2ird1 UTSW 5 134361039 missense probably damaging 1.00
R6787:Gtf2ird1 UTSW 5 134363912 missense probably damaging 0.99
R6981:Gtf2ird1 UTSW 5 134383922 splice site probably benign
R7208:Gtf2ird1 UTSW 5 134411094 missense probably benign 0.35
R7271:Gtf2ird1 UTSW 5 134404904 missense probably benign 0.01
X0026:Gtf2ird1 UTSW 5 134376102 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCTAAAGTGGGTGGGGCTAAAC -3'
(R):5'- GCTTGACATCAACCTACGGC -3'

Sequencing Primer
(F):5'- CAGATGAGGTGGGTCAGGTTC -3'
(R):5'- ACGGCCAATGTGCTCTTG -3'
Posted On2016-11-21