Incidental Mutation 'R7297:Slc27a2'
ID566715
Institutional Source Beutler Lab
Gene Symbol Slc27a2
Ensembl Gene ENSMUSG00000027359
Gene Namesolute carrier family 27 (fatty acid transporter), member 2
SynonymsVLCS, ACSVL1, Vlac, FATP2, FATP2, Vlacs
Accession Numbers

Genbank: NM_011978.2 ; Ensembl: ENSMUST00000061491, ENSMUST00000141482, ENSMUST00000126249, ENSMUST00000150947

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7297 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location126552407-126588243 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 126578946 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 452 (D452E)
Ref Sequence ENSEMBL: ENSMUSP00000057595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061491] [ENSMUST00000141482]
Predicted Effect probably damaging
Transcript: ENSMUST00000061491
AA Change: D452E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000057595
Gene: ENSMUSG00000027359
AA Change: D452E

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 41 53 N/A INTRINSIC
Pfam:AMP-binding 59 488 1.4e-71 PFAM
Pfam:AMP-binding_C 496 572 1.9e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000141482
AA Change: D316E
SMART Domains Protein: ENSMUSP00000117145
Gene: ENSMUSG00000027359
AA Change: D316E

DomainStartEndE-ValueType
Pfam:AMP-binding 7 256 6.2e-38 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an isozyme of long-chain fatty-acid-coenzyme A ligase family. Although differing in substrate specificity, subcellular localization, and tissue distribution, all isozymes of this family convert free long-chain fatty acids into fatty acyl-CoA esters, and thereby play a key role in lipid biosynthesis and fatty acid degradation. This isozyme activates long-chain, branched-chain and very-long-chain fatty acids containing 22 or more carbons to their CoA derivatives. It is expressed primarily in liver and kidney, and is present in both endoplasmic reticulum and peroxisomes, but not in mitochondria. Its decreased peroxisomal enzyme activity is in part responsible for the biochemical pathology in X-linked adrenoleukodystrophy. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous mutant mice are viable and show no gross morphological abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 A G 2: 25,442,076 D1400G probably benign Het
Abca6 C T 11: 110,183,026 probably null Het
Adh4 A G 3: 138,429,140 I358M possibly damaging Het
Akap6 T G 12: 52,887,364 D546E probably benign Het
Arap3 G A 18: 37,973,563 A1409V possibly damaging Het
Arhgap22 C T 14: 33,271,933 R68* probably null Het
Arhgef4 A T 1: 34,807,192 D207V probably damaging Het
Asb15 A G 6: 24,566,463 T472A probably damaging Het
Ascl1 A T 10: 87,492,464 S209T probably damaging Het
Asxl1 T C 2: 153,397,435 V382A probably benign Het
Atp11a T C 8: 12,806,774 probably null Het
Calu C T 6: 29,356,555 R27* probably null Het
Cdh20 A G 1: 104,970,873 T442A probably benign Het
Chrm3 T A 13: 9,877,833 Q389L probably benign Het
Cntnap1 A G 11: 101,188,634 T1233A probably benign Het
Cwc15 G A 9: 14,510,229 C197Y probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dennd3 C T 15: 73,557,610 T914I probably damaging Het
Dlx3 C A 11: 95,120,450 Y43* probably null Het
Dnah17 A T 11: 118,055,730 probably null Het
Dnah17 A G 11: 118,103,356 F1081S probably damaging Het
Dpp10 G A 1: 123,353,428 Q631* probably null Het
Dsel T A 1: 111,861,776 D343V probably damaging Het
Efcab12 T C 6: 115,811,036 D655G possibly damaging Het
Epha8 T A 4: 136,945,913 I187L probably damaging Het
Exosc10 A G 4: 148,580,377 K781E probably damaging Het
Exosc5 T C 7: 25,666,326 L200P probably benign Het
Faiml T C 9: 99,229,613 E131G probably damaging Het
Gm13723 A T 2: 86,873,636 V29E probably damaging Het
Gm5145 G A 17: 20,570,731 V124I probably benign Het
Grm7 T C 6: 110,646,013 V49A probably benign Het
Gtf2e1 T C 16: 37,536,065 D35G probably damaging Het
Heatr1 C T 13: 12,421,060 Q1160* probably null Het
Herc2 T A 7: 56,136,658 C1584S probably benign Het
Hsd17b3 T C 13: 64,076,351 I88V probably damaging Het
Hspa14 A C 2: 3,498,142 L205R possibly damaging Het
Ifna11 A C 4: 88,820,425 E156A possibly damaging Het
Krt83 T C 15: 101,489,647 D170G probably benign Het
Mas1 T C 17: 12,841,858 Y226C probably damaging Het
Micall1 T C 15: 79,120,897 F190L unknown Het
Msi2 A T 11: 88,480,038 L141Q probably damaging Het
Nfkbib T C 7: 28,766,343 D27G probably benign Het
Nlrp9b A G 7: 20,049,513 D927G possibly damaging Het
Nrg3 T C 14: 38,370,939 D579G probably benign Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr26 G A 9: 38,855,949 D296N probably damaging Het
Parp4 C T 14: 56,647,681 P1406S not run Het
Pkib A T 10: 57,736,326 Q101L possibly damaging Het
Plat C T 8: 22,775,697 T252I probably benign Het
Ppm1d A T 11: 85,345,995 E533D probably damaging Het
Psd3 T C 8: 68,121,034 K165R probably damaging Het
Psg29 T A 7: 17,210,691 Y375* probably null Het
Pus7 A T 5: 23,741,910 I644N probably damaging Het
Rbbp9 A T 2: 144,543,802 M181K probably benign Het
Rell1 A T 5: 63,936,075 N112K possibly damaging Het
Simc1 AATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAG AATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAG 13: 54,525,235 probably benign Het
Skint5 G A 4: 113,542,934 T1184M unknown Het
Slc44a4 T A 17: 34,927,912 I489N probably damaging Het
Slfn14 T A 11: 83,278,995 K608* probably null Het
Snx15 T A 19: 6,120,507 I301F probably damaging Het
Sost C T 11: 101,964,103 G127R probably damaging Het
Stt3b A G 9: 115,276,957 I150T probably damaging Het
Susd2 T C 10: 75,642,568 D58G probably benign Het
Tex46 T G 4: 136,612,901 V99G probably damaging Het
Tgfbi T A 13: 56,632,113 F492I possibly damaging Het
Tmem132c G A 5: 127,360,217 A257T probably benign Het
Trim2 A T 3: 84,210,233 I51K probably damaging Het
Tsn A T 1: 118,300,861 Y210* probably null Het
Umodl1 G A 17: 31,008,665 R1324H probably benign Het
Utp3 G C 5: 88,554,517 probably benign Het
Vmn1r5 A T 6: 56,986,219 N293I possibly damaging Het
Vmn2r124 A T 17: 18,073,573 I641F probably damaging Het
Vmn2r84 T C 10: 130,391,250 N240D probably benign Het
Wbp1l A G 19: 46,654,400 D264G possibly damaging Het
Other mutations in Slc27a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Slc27a2 APN 2 126580917 missense probably damaging 1.00
IGL01907:Slc27a2 APN 2 126587874 missense probably benign 0.02
IGL02185:Slc27a2 APN 2 126567816 missense probably damaging 0.99
IGL02363:Slc27a2 APN 2 126578950 missense possibly damaging 0.58
IGL02451:Slc27a2 APN 2 126578992 missense probably benign 0.00
IGL02486:Slc27a2 APN 2 126553350 missense probably benign 0.00
IGL03217:Slc27a2 APN 2 126586252 missense possibly damaging 0.80
IGL03287:Slc27a2 APN 2 126553392 missense probably damaging 1.00
IGL03291:Slc27a2 APN 2 126564750 missense probably benign 0.14
baseboard UTSW 2 126567780 missense probably damaging 0.97
B6584:Slc27a2 UTSW 2 126561642 missense possibly damaging 0.94
R0021:Slc27a2 UTSW 2 126567886 splice site probably benign
R0647:Slc27a2 UTSW 2 126587916 missense probably benign 0.00
R1326:Slc27a2 UTSW 2 126564770 missense probably damaging 1.00
R1509:Slc27a2 UTSW 2 126553314 missense possibly damaging 0.95
R1907:Slc27a2 UTSW 2 126586342 missense probably benign 0.13
R2012:Slc27a2 UTSW 2 126553615 missense probably damaging 0.98
R2217:Slc27a2 UTSW 2 126567752 missense probably damaging 0.99
R3769:Slc27a2 UTSW 2 126567798 missense possibly damaging 0.90
R3770:Slc27a2 UTSW 2 126567798 missense possibly damaging 0.90
R5244:Slc27a2 UTSW 2 126578855 missense probably benign 0.00
R5459:Slc27a2 UTSW 2 126580992 missense probably damaging 0.98
R5582:Slc27a2 UTSW 2 126564690 missense probably damaging 1.00
R5606:Slc27a2 UTSW 2 126564690 missense probably damaging 1.00
R5655:Slc27a2 UTSW 2 126578939 missense probably damaging 1.00
R5680:Slc27a2 UTSW 2 126561610 missense probably benign 0.02
R5747:Slc27a2 UTSW 2 126564738 missense probably benign
R6346:Slc27a2 UTSW 2 126587880 missense probably damaging 0.97
R7042:Slc27a2 UTSW 2 126567780 missense probably damaging 0.97
R7323:Slc27a2 UTSW 2 126553204 missense probably benign 0.38
R7391:Slc27a2 UTSW 2 126553162 missense unknown
Predicted Primers PCR Primer
(F):5'- CTATAGCCAACGTATTGCCAGC -3'
(R):5'- TTCTGGCTTCGGAATAGAGC -3'

Sequencing Primer
(F):5'- GCGGGCCCTCAATAAGAC -3'
(R):5'- CTGGCTTCGGAATAGAGCAAAGTG -3'
Posted On2019-06-26