Incidental Mutation 'R7346:Adra1a'
ID570224
Institutional Source Beutler Lab
Gene Symbol Adra1a
Ensembl Gene ENSMUSG00000045875
Gene Nameadrenergic receptor, alpha 1a
SynonymsAdra1c
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R7346 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location66635251-66771168 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 66638284 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 236 (I236N)
Ref Sequence ENSEMBL: ENSMUSP00000053703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054661] [ENSMUST00000159068] [ENSMUST00000159365] [ENSMUST00000161339] [ENSMUST00000225182]
Predicted Effect probably benign
Transcript: ENSMUST00000054661
AA Change: I236N

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000053703
Gene: ENSMUSG00000045875
AA Change: I236N

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 37 341 4.4e-18 PFAM
Pfam:7tm_1 43 326 1.7e-80 PFAM
Pfam:7TM_GPCR_Srv 44 343 4.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159068
AA Change: I236N

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000124570
Gene: ENSMUSG00000045875
AA Change: I236N

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 37 341 4.4e-18 PFAM
Pfam:7tm_1 43 326 3e-84 PFAM
Pfam:7TM_GPCR_Srv 44 343 3.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159365
AA Change: I236N

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000124322
Gene: ENSMUSG00000045875
AA Change: I236N

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 37 341 1.7e-17 PFAM
Pfam:7tm_1 43 326 1.8e-83 PFAM
Pfam:7TM_GPCR_Srv 44 343 7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161339
AA Change: I236N

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000125354
Gene: ENSMUSG00000045875
AA Change: I236N

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 37 341 4.4e-18 PFAM
Pfam:7tm_1 43 326 3e-84 PFAM
Pfam:7TM_GPCR_Srv 44 343 3.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000225182
AA Change: I236N

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes one of several multipass transmembrane proteins that function as G protein-coupled receptors. The encoded protein binds to epinephrine and norepinephrine to mediate signaling in cells of the cardiac, nervous, and other organ systems. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mutations in this gene result in hypotension. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik G A 9: 56,007,303 P52S unknown Het
Adarb2 A G 13: 8,570,384 E302G probably damaging Het
Adgrf5 T A 17: 43,451,179 L1255H probably damaging Het
As3mt T C 19: 46,720,452 F295S probably damaging Het
Bmp5 G A 9: 75,873,360 R313Q probably damaging Het
Ccnj T A 19: 40,844,950 S191T probably benign Het
Clk2 T A 3: 89,173,545 probably null Het
Cpz T C 5: 35,517,656 E83G probably damaging Het
Cts3 A G 13: 61,567,620 I133T probably benign Het
Dsel A T 1: 111,861,068 V579D probably damaging Het
Dync1h1 C A 12: 110,635,642 A2038E probably damaging Het
Eaf1 A G 14: 31,494,820 probably benign Het
Fsip2 A C 2: 82,998,180 I6774L probably benign Het
Glis2 T C 16: 4,613,568 F320L possibly damaging Het
Hcar1 A G 5: 123,879,630 probably benign Het
Hectd1 A T 12: 51,750,321 H2211Q probably benign Het
Hmcn1 A G 1: 150,683,745 I2385T probably damaging Het
Ifi44 T A 3: 151,732,457 M398L probably benign Het
Il16 C T 7: 83,644,041 E1273K probably damaging Het
Inpp5j G A 11: 3,501,065 T528I probably damaging Het
Kbtbd6 C T 14: 79,453,187 P441S probably damaging Het
Kcnt1 C T 2: 25,863,843 probably benign Het
Kif26b T C 1: 178,530,741 L139P probably damaging Het
Klb C T 5: 65,348,631 Q74* probably null Het
L3mbtl1 G A 2: 162,967,006 V600I probably benign Het
Lcp1 C T 14: 75,210,506 A317V possibly damaging Het
Lipc C T 9: 70,812,747 G326D probably damaging Het
Mbnl2 T A 14: 120,379,282 F103I probably benign Het
Mdm1 G T 10: 118,164,288 E609* probably null Het
Med16 A G 10: 79,908,816 probably null Het
Mga T C 2: 119,935,527 V1424A possibly damaging Het
Mpc2 T A 1: 165,479,511 W94R probably damaging Het
Mrm3 G A 11: 76,250,176 V337I possibly damaging Het
N4bp3 T C 11: 51,645,606 H133R probably benign Het
Ncam2 G T 16: 81,623,368 G810V probably damaging Het
Nipbl T C 15: 8,343,606 E1052G possibly damaging Het
Nlrp12 C T 7: 3,249,257 V95M probably damaging Het
Nrip1 T C 16: 76,293,356 N438D possibly damaging Het
Nsun4 C A 4: 116,051,838 M508I probably benign Het
Pla2g2c T C 4: 138,734,339 S40P probably damaging Het
Plec A G 15: 76,197,978 probably null Het
Ppfia2 G T 10: 106,857,495 M620I possibly damaging Het
Ppp6c A G 2: 39,226,217 Y9H probably damaging Het
Prkd1 A T 12: 50,648,834 I47N possibly damaging Het
Prr14l T C 5: 32,830,684 D489G probably benign Het
Ptch2 T A 4: 117,114,652 Y1124N probably benign Het
Ptpra T G 2: 130,553,400 Y808D probably damaging Het
Rint1 T A 5: 23,815,653 F558Y possibly damaging Het
Rnf215 T A 11: 4,139,792 C268* probably null Het
Slc25a13 T C 6: 6,181,100 E28G possibly damaging Het
Slc38a8 G T 8: 119,499,815 Y78* probably null Het
Slc4a7 T C 14: 14,775,000 M810T probably damaging Het
Slitrk1 A G 14: 108,913,159 V40A possibly damaging Het
Sobp A T 10: 43,022,835 S251R probably damaging Het
Spata31d1a G A 13: 59,703,201 S371L probably benign Het
Tada2b T C 5: 36,476,836 T133A possibly damaging Het
Tbc1d20 A G 2: 152,304,961 D90G probably benign Het
Tek T A 4: 94,827,296 I408K probably benign Het
Tgfb2 A G 1: 186,649,880 F150S probably benign Het
Tmem63b T C 17: 45,666,591 T370A probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tspan17 C G 13: 54,792,621 L34V probably benign Het
Vmn1r238 A T 18: 3,123,151 Y88N probably damaging Het
Vmn1r85 A G 7: 13,085,037 I60T probably damaging Het
Vmn2r96 T C 17: 18,582,767 M313T probably benign Het
Zp3r G A 1: 130,583,480 S387F probably benign Het
Other mutations in Adra1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02466:Adra1a APN 14 66637873 missense probably damaging 1.00
IGL02751:Adra1a APN 14 66727532 missense possibly damaging 0.76
IGL02755:Adra1a APN 14 66727661 missense probably benign
IGL03367:Adra1a APN 14 66637989 missense possibly damaging 0.89
R0610:Adra1a UTSW 14 66637792 missense probably damaging 1.00
R0840:Adra1a UTSW 14 66727710 missense possibly damaging 0.73
R1720:Adra1a UTSW 14 66638278 missense probably damaging 1.00
R1902:Adra1a UTSW 14 66638235 missense probably benign 0.30
R2131:Adra1a UTSW 14 66727532 missense possibly damaging 0.76
R2198:Adra1a UTSW 14 66637936 missense probably damaging 1.00
R4702:Adra1a UTSW 14 66637559 start gained probably benign
R4761:Adra1a UTSW 14 66727431 splice site probably null
R4784:Adra1a UTSW 14 66637824 missense probably damaging 1.00
R4814:Adra1a UTSW 14 66638032 missense probably benign 0.01
R5844:Adra1a UTSW 14 66727734 missense probably benign 0.02
Z1088:Adra1a UTSW 14 66727496 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTGGTCATCTCCATCGGACC -3'
(R):5'- TCACCAATGGGCATCACGAG -3'

Sequencing Primer
(F):5'- TCTGCCAAATCAATGAGGAGC -3'
(R):5'- TCACGAGGAAGAATGGCAGCC -3'
Posted On2019-09-13