Incidental Mutation 'R0627:Myo16'
ID57620
Institutional Source Beutler Lab
Gene Symbol Myo16
Ensembl Gene ENSMUSG00000039057
Gene Namemyosin XVI
SynonymsBM140241, C230040D10Rik, Nyap3
MMRRC Submission 038816-MU
Accession Numbers

Genbank: NM_001081397; MGI: 2685951

Is this an essential gene? Possibly essential (E-score: 0.516) question?
Stock #R0627 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location10153911-10634742 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10439689 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 715 (I715V)
Ref Sequence ENSEMBL: ENSMUSP00000049345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042103] [ENSMUST00000207204] [ENSMUST00000207477]
Predicted Effect probably benign
Transcript: ENSMUST00000042103
AA Change: I715V

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000049345
Gene: ENSMUSG00000039057
AA Change: I715V

DomainStartEndE-ValueType
ANK 92 121 1.65e-1 SMART
ANK 125 154 3.46e-4 SMART
ANK 158 189 2.11e2 SMART
ANK 221 250 2.85e-5 SMART
ANK 254 283 3.51e-5 SMART
low complexity region 333 349 N/A INTRINSIC
MYSc 394 1144 2.27e-144 SMART
IQ 1144 1166 4.06e-2 SMART
Pfam:NYAP_N 1207 1591 4.1e-135 PFAM
low complexity region 1670 1690 N/A INTRINSIC
low complexity region 1841 1860 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000207204
AA Change: I659V
Predicted Effect unknown
Transcript: ENSMUST00000207477
AA Change: I715V
Meta Mutation Damage Score 0.052 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 94.2%
Validation Efficiency 99% (111/112)
MGI Phenotype PHENOTYPE: Triple KO of Nyap1, Nyap2 and Myo16 results in decreased brain weight and cortex and striatum size and reduced neurite length in cortical neurons. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A G 1: 26,685,889 M70T probably benign Het
Adm2 T A 15: 89,324,305 Y149* probably null Het
Ahi1 G A 10: 20,965,522 R236H probably benign Het
Armcx4 A G X: 134,695,823 N2160S possibly damaging Het
Asns A T 6: 7,675,516 D495E probably benign Het
Bcl9 A G 3: 97,205,473 V1222A probably damaging Het
Cd46 A T 1: 195,092,186 C14S probably benign Het
Cdk11b T A 4: 155,640,772 probably benign Het
Cdkl3 T C 11: 52,011,308 Y115H probably damaging Het
Cep41 C A 6: 30,656,631 C274F probably damaging Het
Ces1a C A 8: 93,042,043 V108F probably benign Het
Clca4b A G 3: 144,928,259 Y132H probably benign Het
Col5a3 T C 9: 20,775,485 E1323G unknown Het
Cttnbp2 A G 6: 18,367,373 *1139Q probably null Het
Cyp2d9 T A 15: 82,455,790 I127N probably damaging Het
Dennd1b A G 1: 139,081,219 Y220C probably damaging Het
Desi2 T C 1: 178,249,352 S141P possibly damaging Het
Dgcr2 A G 16: 17,844,008 S453P probably damaging Het
Dnah3 A G 7: 120,020,915 L1586P probably damaging Het
Dpep3 T C 8: 105,978,731 D129G possibly damaging Het
Eci3 C T 13: 34,948,143 V241I possibly damaging Het
Ecm2 A T 13: 49,521,083 probably benign Het
Emilin3 A G 2: 160,908,176 L551P probably damaging Het
Erap1 A C 13: 74,675,814 probably benign Het
Ern1 T C 11: 106,398,693 D928G probably benign Het
Fam214b G T 4: 43,036,242 P163Q probably damaging Het
Fancc C A 13: 63,317,478 A472S probably damaging Het
Fkbp7 A T 2: 76,672,844 D57E probably damaging Het
Gabbr2 T A 4: 46,681,223 I703F possibly damaging Het
Gabrg3 A T 7: 56,724,595 C408S probably damaging Het
Gm13119 C A 4: 144,362,846 L245I probably benign Het
Gm13757 A G 2: 88,446,219 S240P probably damaging Het
Gm8674 T C 13: 49,899,715 noncoding transcript Het
Gnas G A 2: 174,298,135 probably benign Het
Grhl3 A G 4: 135,552,681 V354A probably benign Het
Gsdme G T 6: 50,229,279 probably benign Het
H2-D1 A G 17: 35,265,922 E253G probably damaging Het
Habp2 A G 19: 56,314,046 T31A probably damaging Het
Ifrd1 A G 12: 40,206,987 probably null Het
Il20 A G 1: 130,909,739 probably benign Het
Isx A T 8: 74,892,700 I160F possibly damaging Het
Itgb2l T G 16: 96,422,911 probably benign Het
Kcnv1 T G 15: 45,112,881 probably benign Het
Kif17 T C 4: 138,288,487 probably null Het
Kirrel3 A C 9: 35,035,174 D743A probably damaging Het
Lmod3 T C 6: 97,248,071 D263G probably damaging Het
Manf A G 9: 106,889,186 L132P probably damaging Het
Mark2 C T 19: 7,281,960 probably null Het
Med10 G A 13: 69,815,601 S107N possibly damaging Het
Med31 A G 11: 72,213,775 probably null Het
Mki67 C A 7: 135,708,258 A155S probably benign Het
Mprip T A 11: 59,769,972 L2193Q probably damaging Het
Mylk A G 16: 35,000,429 N126S probably damaging Het
Myo18b T C 5: 112,798,834 T1591A probably benign Het
Myt1 T A 2: 181,795,689 D64E probably benign Het
Ndufa10 A T 1: 92,469,896 Y61N probably damaging Het
Nob1 A G 8: 107,416,224 F275S probably damaging Het
Nop2 T C 6: 125,139,704 V333A possibly damaging Het
Ogdh T A 11: 6,347,216 V545D possibly damaging Het
Olfr1101 T C 2: 86,989,014 N54S probably benign Het
Olfr1461 A G 19: 13,165,250 T79A probably benign Het
Olfr213 T A 6: 116,540,988 N178K possibly damaging Het
Olfr364-ps1 T G 2: 37,146,330 N39K probably damaging Het
Olfr430 G T 1: 174,070,077 V260F probably damaging Het
Olfr826 A G 10: 130,180,688 F64S probably damaging Het
Pcdhb1 T C 18: 37,265,721 F242L probably damaging Het
Pkd2l2 A G 18: 34,425,102 Y278C probably damaging Het
Plxdc1 T A 11: 97,932,204 probably null Het
Ppp2r5b A G 19: 6,232,634 probably benign Het
Prelid2 T A 18: 41,937,652 T39S possibly damaging Het
Prkd1 A T 12: 50,490,041 F87I probably benign Het
Prl3d3 C T 13: 27,156,847 T4I probably damaging Het
Proser3 T A 7: 30,540,783 T299S probably benign Het
Ptprc G T 1: 138,068,320 H1095N probably damaging Het
Rab11fip5 G T 6: 85,348,051 P425T probably benign Het
Rac2 T C 15: 78,564,968 T115A probably damaging Het
Rtl9 C A X: 143,101,275 T561K possibly damaging Het
Runx2 T C 17: 44,658,505 probably benign Het
Rxfp1 C T 3: 79,648,211 V613I probably benign Het
Scn9a T C 2: 66,537,377 K656R probably benign Het
Sec31b A G 19: 44,525,607 S406P probably benign Het
Sept5 T C 16: 18,625,365 D44G possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc35c2 T C 2: 165,282,136 T94A possibly damaging Het
Slc8a3 T A 12: 81,314,842 D401V probably damaging Het
Slitrk1 A T 14: 108,912,239 C347S probably damaging Het
Smg1 G T 7: 118,167,861 probably benign Het
Snx14 T C 9: 88,394,430 K610E probably benign Het
Sppl2a A G 2: 126,920,417 probably benign Het
Stk-ps2 T A 1: 46,029,691 noncoding transcript Het
Sult3a1 T C 10: 33,864,014 M23T probably benign Het
Syt5 A G 7: 4,545,683 L50P possibly damaging Het
Tacr1 A G 6: 82,555,031 I303V possibly damaging Het
Trip12 C A 1: 84,768,597 V487F probably damaging Het
Vcp A G 4: 42,983,011 S612P possibly damaging Het
Vmn1r47 A G 6: 90,022,806 I307V probably null Het
Vmn1r83 T G 7: 12,321,992 D46A probably damaging Het
Vmn2r118 G T 17: 55,610,772 Q247K probably benign Het
Vmn2r94 C T 17: 18,257,165 C328Y probably damaging Het
Vps13b T A 15: 35,371,999 Y13* probably null Het
Vps13d C T 4: 145,087,184 R3241H probably damaging Het
Wdr5b A G 16: 36,042,470 T320A probably benign Het
Zfhx2 A T 14: 55,065,327 D1733E probably benign Het
Zfp541 A G 7: 16,095,682 probably benign Het
Zfp708 A T 13: 67,070,717 Y314* probably null Het
Other mutations in Myo16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Myo16 APN 8 10438889 missense probably damaging 1.00
IGL00567:Myo16 APN 8 10462154 missense probably damaging 1.00
IGL00671:Myo16 APN 8 10361067 missense probably damaging 1.00
IGL00897:Myo16 APN 8 10315518 missense probably damaging 1.00
IGL01458:Myo16 APN 8 10435853 missense probably damaging 1.00
IGL01523:Myo16 APN 8 10370908 missense probably damaging 1.00
IGL01532:Myo16 APN 8 10400551 missense probably benign 0.00
IGL01680:Myo16 APN 8 10272630 missense probably damaging 1.00
IGL01747:Myo16 APN 8 10604877 missense probably damaging 1.00
IGL02084:Myo16 APN 8 10361088 missense probably damaging 0.99
IGL02203:Myo16 APN 8 10570132 missense possibly damaging 0.52
IGL02506:Myo16 APN 8 10390217 missense probably damaging 1.00
IGL02819:Myo16 APN 8 10322600 missense probably damaging 1.00
IGL02935:Myo16 APN 8 10532990 missense probably benign 0.41
IGL02943:Myo16 APN 8 10400595 splice site probably benign
IGL03347:Myo16 APN 8 10376120 critical splice acceptor site probably null
3-1:Myo16 UTSW 8 10438869 missense probably damaging 0.99
P0016:Myo16 UTSW 8 10400596 splice site probably benign
R0006:Myo16 UTSW 8 10475988 missense probably damaging 0.98
R0006:Myo16 UTSW 8 10475988 missense probably damaging 0.98
R0033:Myo16 UTSW 8 10370955 missense probably damaging 1.00
R0033:Myo16 UTSW 8 10370955 missense probably damaging 1.00
R0142:Myo16 UTSW 8 10569790 missense probably benign 0.01
R0195:Myo16 UTSW 8 10315538 splice site probably benign
R0418:Myo16 UTSW 8 10569918 missense probably benign 0.01
R0576:Myo16 UTSW 8 10562318 critical splice donor site probably null
R0826:Myo16 UTSW 8 10376285 splice site probably benign
R0835:Myo16 UTSW 8 10272766 missense probably damaging 1.00
R1015:Myo16 UTSW 8 10390183 missense probably benign 0.17
R1052:Myo16 UTSW 8 10570181 missense possibly damaging 0.92
R1180:Myo16 UTSW 8 10396908 missense probably damaging 1.00
R1185:Myo16 UTSW 8 10633624 missense probably damaging 1.00
R1185:Myo16 UTSW 8 10633624 missense probably damaging 1.00
R1474:Myo16 UTSW 8 10502796 missense probably damaging 1.00
R1484:Myo16 UTSW 8 10560145 missense probably damaging 1.00
R1503:Myo16 UTSW 8 10502817 missense probably benign 0.44
R1733:Myo16 UTSW 8 10442283 missense probably damaging 0.98
R1873:Myo16 UTSW 8 10272789 missense probably damaging 1.00
R1885:Myo16 UTSW 8 10322656 missense probably damaging 1.00
R1943:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2013:Myo16 UTSW 8 10502796 missense probably damaging 1.00
R2019:Myo16 UTSW 8 10376260 missense probably benign 0.05
R2022:Myo16 UTSW 8 10272633 missense probably benign 0.08
R2214:Myo16 UTSW 8 10438803 missense probably damaging 1.00
R2228:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2351:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2352:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2357:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2566:Myo16 UTSW 8 10594820 missense probably benign 0.43
R3402:Myo16 UTSW 8 10384719 missense probably benign
R3870:Myo16 UTSW 8 10442239 missense probably benign 0.25
R4080:Myo16 UTSW 8 10562240 missense probably damaging 1.00
R4498:Myo16 UTSW 8 10435869 missense probably benign 0.01
R4631:Myo16 UTSW 8 10506984 missense probably damaging 1.00
R4689:Myo16 UTSW 8 10438890 missense probably damaging 1.00
R4736:Myo16 UTSW 8 10373527 missense probably damaging 1.00
R4738:Myo16 UTSW 8 10373527 missense probably damaging 1.00
R4739:Myo16 UTSW 8 10373527 missense probably damaging 1.00
R4764:Myo16 UTSW 8 10435880 missense probably damaging 1.00
R4778:Myo16 UTSW 8 10569694 missense probably damaging 0.97
R4852:Myo16 UTSW 8 10373474 missense probably damaging 1.00
R4885:Myo16 UTSW 8 10438892 missense probably damaging 0.98
R4993:Myo16 UTSW 8 10476094 missense probably damaging 0.99
R5077:Myo16 UTSW 8 10322658 missense probably damaging 1.00
R5135:Myo16 UTSW 8 10476114 missense probably benign
R5170:Myo16 UTSW 8 10569745 missense probably benign 0.30
R5203:Myo16 UTSW 8 10360995 missense probably damaging 1.00
R5246:Myo16 UTSW 8 10562212 nonsense probably null
R5517:Myo16 UTSW 8 10560226 missense probably benign 0.22
R5567:Myo16 UTSW 8 10322676 missense probably damaging 1.00
R5694:Myo16 UTSW 8 10569606 missense probably benign 0.01
R5749:Myo16 UTSW 8 10413245 missense probably benign 0.01
R6131:Myo16 UTSW 8 10569877 missense probably benign
R6213:Myo16 UTSW 8 10370963 critical splice donor site probably null
R6216:Myo16 UTSW 8 10315494 missense probably benign 0.01
R6240:Myo16 UTSW 8 10370930 missense probably damaging 1.00
R6628:Myo16 UTSW 8 10570638 missense probably damaging 0.99
R6935:Myo16 UTSW 8 10569820 missense probably benign 0.37
R6996:Myo16 UTSW 8 10569496 missense probably damaging 1.00
R7103:Myo16 UTSW 8 10569673 missense unknown
R7164:Myo16 UTSW 8 10569585 missense unknown
R7255:Myo16 UTSW 8 10499169 missense unknown
R7266:Myo16 UTSW 8 10272687 missense unknown
R7398:Myo16 UTSW 8 10562183 missense unknown
X0066:Myo16 UTSW 8 10376185 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACACAAGATCCCACCAGTGTCTG -3'
(R):5'- GGCTCCATGCCATTCCCTCATAAAC -3'

Sequencing Primer
(F):5'- CCACCAGTGTCTGGAGTACTAAG -3'
(R):5'- GGGCTAGTTACTCAGAATGATCTCC -3'
Posted On2013-07-11