Incidental Mutation 'R0142:Myo16'
ID22381
Institutional Source Beutler Lab
Gene Symbol Myo16
Ensembl Gene ENSMUSG00000039057
Gene Namemyosin XVI
SynonymsBM140241, C230040D10Rik, Nyap3
MMRRC Submission 038427-MU
Accession Numbers

Genbank: NM_001081397; MGI: 2685951

Is this an essential gene? Possibly non essential (E-score: 0.415) question?
Stock #R0142 (G1)
Quality Score225
Status Validated (trace)
Chromosome8
Chromosomal Location10153911-10634742 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 10569790 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1447 (I1447N)
Ref Sequence ENSEMBL: ENSMUSP00000049345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042103] [ENSMUST00000207204] [ENSMUST00000207477]
Predicted Effect probably benign
Transcript: ENSMUST00000042103
AA Change: I1447N

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000049345
Gene: ENSMUSG00000039057
AA Change: I1447N

DomainStartEndE-ValueType
ANK 92 121 1.65e-1 SMART
ANK 125 154 3.46e-4 SMART
ANK 158 189 2.11e2 SMART
ANK 221 250 2.85e-5 SMART
ANK 254 283 3.51e-5 SMART
low complexity region 333 349 N/A INTRINSIC
MYSc 394 1144 2.27e-144 SMART
IQ 1144 1166 4.06e-2 SMART
Pfam:NYAP_N 1207 1591 4.1e-135 PFAM
low complexity region 1670 1690 N/A INTRINSIC
low complexity region 1841 1860 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000207204
AA Change: I1391N
Predicted Effect unknown
Transcript: ENSMUST00000207477
AA Change: I1447N
Meta Mutation Damage Score 0.112 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 87.6%
Validation Efficiency 92% (61/66)
MGI Phenotype PHENOTYPE: Triple KO of Nyap1, Nyap2 and Myo16 results in decreased brain weight and cortex and striatum size and reduced neurite length in cortical neurons. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A G 19: 29,718,254 S1347P possibly damaging Het
Abca6 T G 11: 110,188,641 D1229A probably damaging Het
Abhd8 A C 8: 71,461,862 F41V probably damaging Het
Ago4 T G 4: 126,516,932 E222A probably benign Het
Ap3b2 T C 7: 81,473,080 I470V probably damaging Het
Bcl9l C T 9: 44,507,112 T749M probably benign Het
Bicc1 T C 10: 70,925,370 K937E probably damaging Het
Bmi1 G A 2: 18,683,284 probably null Het
Boc A C 16: 44,490,241 I772S probably damaging Het
C2 T A 17: 34,873,528 I178F possibly damaging Het
Cacna1c G T 6: 118,603,882 A1416E probably damaging Het
Chst10 A G 1: 38,871,729 L118P probably damaging Het
Crybg1 G A 10: 43,999,063 T683I possibly damaging Het
Cul5 C T 9: 53,635,050 V314I probably damaging Het
Dnajc17 C A 2: 119,179,934 R211I probably benign Het
Emilin1 A G 5: 30,913,920 T16A probably benign Het
Ercc6l2 A C 13: 63,872,506 probably benign Het
Fsd2 T A 7: 81,559,935 D53V probably damaging Het
Galnt13 A G 2: 55,098,603 D479G probably damaging Het
Grk3 A T 5: 112,915,053 W643R probably damaging Het
Hdgf G A 3: 87,913,109 A4T possibly damaging Het
Hnrnpr T A 4: 136,327,282 V182E probably damaging Het
Ipo13 A C 4: 117,905,569 L279R probably damaging Het
Itga9 C A 9: 118,636,586 N169K probably damaging Het
Jph3 A G 8: 121,753,371 T263A possibly damaging Het
Jph4 G T 14: 55,108,326 Q625K probably benign Het
Kctd3 A C 1: 188,996,398 probably null Het
Kif26b A T 1: 178,915,389 S570C probably damaging Het
Klhl5 G A 5: 65,143,350 W164* probably null Het
Lacc1 A T 14: 77,030,799 H357Q probably benign Het
Lama2 A G 10: 27,187,845 I1316T probably benign Het
Lcp2 C T 11: 34,082,418 P332L probably damaging Het
Map3k6 A T 4: 133,250,946 H1033L probably benign Het
Mfsd2b A G 12: 4,866,234 V252A probably benign Het
Myo19 G A 11: 84,894,603 R224H probably damaging Het
Myo5a C T 9: 75,160,574 H637Y probably benign Het
Nek10 C T 14: 14,861,560 R539C possibly damaging Het
Nfix A T 8: 84,721,686 V404E probably damaging Het
Nr1i2 T C 16: 38,253,006 R203G probably benign Het
Nup210l G A 3: 90,172,113 G968D probably damaging Het
Olfr1494 A T 19: 13,749,255 I50F probably benign Het
Olfr697 G T 7: 106,741,765 H56Q probably benign Het
Olfr884 A T 9: 38,048,110 H296L probably benign Het
Phlpp2 C T 8: 109,907,513 R242W probably damaging Het
Plcz1 A G 6: 140,007,697 F398S probably damaging Het
Ppfibp2 C A 7: 107,744,177 P808T probably damaging Het
Srpk2 T C 5: 23,527,930 K239E probably damaging Het
Svep1 A G 4: 58,118,232 V830A probably benign Het
Tesc A T 5: 118,056,570 I149F possibly damaging Het
Thsd7a A G 6: 12,418,335 W632R probably damaging Het
Tmprss9 A G 10: 80,894,378 D704G possibly damaging Het
Tob1 T C 11: 94,214,597 Y320H probably damaging Het
Trpm3 G T 19: 22,987,916 D1582Y probably damaging Het
Ttc28 A G 5: 111,277,457 K1716R probably benign Het
Uqcrfs1 A G 13: 30,540,942 V205A probably benign Het
Usp29 G A 7: 6,962,335 M392I probably benign Het
Uspl1 A T 5: 149,188,349 Y22F possibly damaging Het
Virma C A 4: 11,548,783 N1780K probably benign Het
Vmn1r56 C T 7: 5,196,373 A82T probably benign Het
Vmn2r5 A T 3: 64,492,588 C553S probably damaging Het
Vwce A T 19: 10,664,612 R901W probably damaging Het
Wdpcp C A 11: 21,857,444 probably null Het
Zfp423 A T 8: 87,780,340 C1000* probably null Het
Zscan20 A G 4: 128,585,837 F954L probably benign Het
Other mutations in Myo16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Myo16 APN 8 10438889 missense probably damaging 1.00
IGL00567:Myo16 APN 8 10462154 missense probably damaging 1.00
IGL00671:Myo16 APN 8 10361067 missense probably damaging 1.00
IGL00897:Myo16 APN 8 10315518 missense probably damaging 1.00
IGL01458:Myo16 APN 8 10435853 missense probably damaging 1.00
IGL01523:Myo16 APN 8 10370908 missense probably damaging 1.00
IGL01532:Myo16 APN 8 10400551 missense probably benign 0.00
IGL01680:Myo16 APN 8 10272630 missense probably damaging 1.00
IGL01747:Myo16 APN 8 10604877 missense probably damaging 1.00
IGL02084:Myo16 APN 8 10361088 missense probably damaging 0.99
IGL02203:Myo16 APN 8 10570132 missense possibly damaging 0.52
IGL02506:Myo16 APN 8 10390217 missense probably damaging 1.00
IGL02819:Myo16 APN 8 10322600 missense probably damaging 1.00
IGL02935:Myo16 APN 8 10532990 missense probably benign 0.41
IGL02943:Myo16 APN 8 10400595 splice site probably benign
IGL03347:Myo16 APN 8 10376120 critical splice acceptor site probably null
3-1:Myo16 UTSW 8 10438869 missense probably damaging 0.99
P0016:Myo16 UTSW 8 10400596 splice site probably benign
R0006:Myo16 UTSW 8 10475988 missense probably damaging 0.98
R0006:Myo16 UTSW 8 10475988 missense probably damaging 0.98
R0033:Myo16 UTSW 8 10370955 missense probably damaging 1.00
R0033:Myo16 UTSW 8 10370955 missense probably damaging 1.00
R0195:Myo16 UTSW 8 10315538 splice site probably benign
R0418:Myo16 UTSW 8 10569918 missense probably benign 0.01
R0576:Myo16 UTSW 8 10562318 critical splice donor site probably null
R0627:Myo16 UTSW 8 10439689 missense probably benign 0.15
R0826:Myo16 UTSW 8 10376285 splice site probably benign
R0835:Myo16 UTSW 8 10272766 missense probably damaging 1.00
R1015:Myo16 UTSW 8 10390183 missense probably benign 0.17
R1052:Myo16 UTSW 8 10570181 missense possibly damaging 0.92
R1180:Myo16 UTSW 8 10396908 missense probably damaging 1.00
R1185:Myo16 UTSW 8 10633624 missense probably damaging 1.00
R1185:Myo16 UTSW 8 10633624 missense probably damaging 1.00
R1474:Myo16 UTSW 8 10502796 missense probably damaging 1.00
R1484:Myo16 UTSW 8 10560145 missense probably damaging 1.00
R1503:Myo16 UTSW 8 10502817 missense probably benign 0.44
R1733:Myo16 UTSW 8 10442283 missense probably damaging 0.98
R1873:Myo16 UTSW 8 10272789 missense probably damaging 1.00
R1885:Myo16 UTSW 8 10322656 missense probably damaging 1.00
R1943:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2013:Myo16 UTSW 8 10502796 missense probably damaging 1.00
R2019:Myo16 UTSW 8 10376260 missense probably benign 0.05
R2022:Myo16 UTSW 8 10272633 missense probably benign 0.08
R2214:Myo16 UTSW 8 10438803 missense probably damaging 1.00
R2228:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2351:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2352:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2357:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2566:Myo16 UTSW 8 10594820 missense probably benign 0.43
R3402:Myo16 UTSW 8 10384719 missense probably benign
R3870:Myo16 UTSW 8 10442239 missense probably benign 0.25
R4080:Myo16 UTSW 8 10562240 missense probably damaging 1.00
R4498:Myo16 UTSW 8 10435869 missense probably benign 0.01
R4631:Myo16 UTSW 8 10506984 missense probably damaging 1.00
R4689:Myo16 UTSW 8 10438890 missense probably damaging 1.00
R4736:Myo16 UTSW 8 10373527 missense probably damaging 1.00
R4738:Myo16 UTSW 8 10373527 missense probably damaging 1.00
R4739:Myo16 UTSW 8 10373527 missense probably damaging 1.00
R4764:Myo16 UTSW 8 10435880 missense probably damaging 1.00
R4778:Myo16 UTSW 8 10569694 missense probably damaging 0.97
R4852:Myo16 UTSW 8 10373474 missense probably damaging 1.00
R4885:Myo16 UTSW 8 10438892 missense probably damaging 0.98
R4993:Myo16 UTSW 8 10476094 missense probably damaging 0.99
R5077:Myo16 UTSW 8 10322658 missense probably damaging 1.00
R5135:Myo16 UTSW 8 10476114 missense probably benign
R5170:Myo16 UTSW 8 10569745 missense probably benign 0.30
R5203:Myo16 UTSW 8 10360995 missense probably damaging 1.00
R5246:Myo16 UTSW 8 10562212 nonsense probably null
R5517:Myo16 UTSW 8 10560226 missense probably benign 0.22
R5567:Myo16 UTSW 8 10322676 missense probably damaging 1.00
R5694:Myo16 UTSW 8 10569606 missense probably benign 0.01
R5749:Myo16 UTSW 8 10413245 missense probably benign 0.01
R6131:Myo16 UTSW 8 10569877 missense probably benign
R6213:Myo16 UTSW 8 10370963 critical splice donor site probably null
R6216:Myo16 UTSW 8 10315494 missense probably benign 0.01
R6240:Myo16 UTSW 8 10370930 missense probably damaging 1.00
R6628:Myo16 UTSW 8 10570638 missense probably damaging 0.99
R6935:Myo16 UTSW 8 10569820 missense probably benign 0.37
R6996:Myo16 UTSW 8 10569496 missense probably damaging 1.00
R7103:Myo16 UTSW 8 10569673 missense unknown
R7164:Myo16 UTSW 8 10569585 missense unknown
R7255:Myo16 UTSW 8 10499169 missense unknown
R7266:Myo16 UTSW 8 10272687 missense unknown
R7398:Myo16 UTSW 8 10562183 missense unknown
X0066:Myo16 UTSW 8 10376185 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACGAAGCTCAGTGGCTCTTATG -3'
(R):5'- GTTTCTTCACCTCCAAGGGTGTCAG -3'

Sequencing Primer
(F):5'- TTATGAGGAGATCTGGGGACCAC -3'
(R):5'- GTCAGTGGAGACTCGTCAG -3'
Posted On2013-04-16