Incidental Mutation 'R0147:Olfr873'
ID60836
Institutional Source Beutler Lab
Gene Symbol Olfr873
Ensembl Gene ENSMUSG00000049028
Gene Nameolfactory receptor 873
SynonymsGA_x6K02T2PVTD-14040245-14041204, MOR145-2
MMRRC Submission 038431-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R0147 (G1)
Quality Score188
Status Validated
Chromosome9
Chromosomal Location20298532-20303599 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 20301091 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 297 (M297R)
Ref Sequence ENSEMBL: ENSMUSP00000153816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053919] [ENSMUST00000075717] [ENSMUST00000215540]
Predicted Effect probably damaging
Transcript: ENSMUST00000053919
AA Change: M294R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054778
Gene: ENSMUSG00000049028
AA Change: M294R

DomainStartEndE-ValueType
Pfam:7tm_4 41 317 1.7e-52 PFAM
Pfam:7TM_GPCR_Srsx 45 315 1.6e-8 PFAM
Pfam:7tm_1 51 300 3e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000075717
AA Change: M298R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075135
Gene: ENSMUSG00000049028
AA Change: M298R

DomainStartEndE-ValueType
Pfam:7tm_4 45 321 6.2e-43 PFAM
Pfam:7TM_GPCR_Srsx 49 309 3e-8 PFAM
Pfam:7tm_1 55 304 1.5e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212393
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213445
Predicted Effect probably damaging
Transcript: ENSMUST00000215540
AA Change: M297R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216567
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217193
Meta Mutation Damage Score 0.026 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 94.5%
  • 20x: 86.1%
Validation Efficiency 67% (88/131)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik C T 18: 12,189,271 R594C probably damaging Het
A2m T C 6: 121,662,446 probably null Het
Abtb2 A G 2: 103,567,135 I137V probably benign Het
Ank1 T A 8: 23,123,977 N1545K probably damaging Het
Arl6 T C 16: 59,618,790 probably benign Het
Avl9 T A 6: 56,736,502 D248E probably benign Het
Becn1 T C 11: 101,301,736 E40G probably damaging Het
Bod1l G T 5: 41,818,697 A1758E possibly damaging Het
Btbd16 C T 7: 130,779,594 T19I probably damaging Het
Casc3 T A 11: 98,822,499 N246K possibly damaging Het
Celf1 G T 2: 91,004,690 probably benign Het
Chrm3 G T 13: 9,878,744 N85K probably damaging Het
Cluh T A 11: 74,665,938 Y935N probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col6a5 T C 9: 105,925,794 D1324G unknown Het
Ctcfl T C 2: 173,118,547 D81G possibly damaging Het
D630003M21Rik C T 2: 158,203,067 probably benign Het
Ddx39 C T 8: 83,722,476 R298C possibly damaging Het
Dnmt3b T G 2: 153,661,457 N9K possibly damaging Het
Dock8 T C 19: 25,119,459 L577P probably benign Het
Drc1 A T 5: 30,281,489 N13I possibly damaging Het
Eml4 T A 17: 83,421,652 N85K probably damaging Het
Epb41l4a T C 18: 33,798,800 T581A probably damaging Het
Epha3 T C 16: 63,612,944 D446G possibly damaging Het
Fam208a A G 14: 27,471,768 D975G probably benign Het
Fam209 G T 2: 172,473,980 G92C probably damaging Het
Fam98c T A 7: 29,152,721 R340* probably null Het
Fbxw10 T G 11: 62,847,481 probably null Het
Galr1 A G 18: 82,405,570 L194P probably benign Het
Gar1 T C 3: 129,829,473 H89R probably damaging Het
Gbp4 T A 5: 105,119,496 Y519F probably benign Het
Gm28042 T A 2: 120,036,463 S196T probably benign Het
Grid2 T C 6: 64,533,587 Y734H probably benign Het
Grm6 T A 11: 50,859,317 I466N possibly damaging Het
Hectd3 T C 4: 116,997,040 probably benign Het
Hpse2 A C 19: 42,931,660 probably null Het
Hspb7 T C 4: 141,423,991 I148T probably damaging Het
Htr1d C A 4: 136,443,477 T339K probably damaging Het
Ip6k1 T A 9: 108,045,894 D408E probably damaging Het
Irs2 A T 8: 11,007,568 M288K probably damaging Het
Kansl3 A T 1: 36,353,816 C225S probably damaging Het
Knop1 C A 7: 118,845,838 R301L probably benign Het
Lama5 T C 2: 180,190,406 H1714R probably benign Het
Mettl14 G A 3: 123,371,394 T316I probably damaging Het
Mmp15 A T 8: 95,372,317 N591Y probably benign Het
Mprip T A 11: 59,737,073 D93E possibly damaging Het
Mtmr14 T A 6: 113,260,666 probably benign Het
Muc5ac T C 7: 141,811,039 S1917P probably benign Het
Muc6 C T 7: 141,651,990 C75Y probably damaging Het
Naip1 A T 13: 100,426,910 H582Q possibly damaging Het
Nbeal2 G A 9: 110,642,143 R264* probably null Het
Neb T C 2: 52,249,376 K140E probably damaging Het
Nfya A G 17: 48,398,998 V48A possibly damaging Het
Ngf G T 3: 102,509,803 probably benign Het
Nsmce2 T G 15: 59,378,957 S26A probably damaging Het
Olfr1026 T A 2: 85,924,018 I250N possibly damaging Het
Olfr601 T C 7: 103,358,406 T263A possibly damaging Het
Pax1 A G 2: 147,373,734 S424G probably benign Het
Pcdhb19 A T 18: 37,497,182 Q10L probably benign Het
Pdcl T C 2: 37,352,130 I203V probably benign Het
Pknox1 T A 17: 31,604,790 N379K probably benign Het
Plxna1 C T 6: 89,320,710 A1831T possibly damaging Het
Prodh T G 16: 18,077,813 Q360P probably damaging Het
Pygo2 T C 3: 89,433,303 V299A probably damaging Het
Raf1 C T 6: 115,632,973 G202S probably benign Het
Rgs11 T A 17: 26,207,459 probably null Het
Rnf13 A G 3: 57,802,468 D144G probably damaging Het
Rtel1 T C 2: 181,321,046 C31R probably damaging Het
Rubcnl T A 14: 75,042,458 I427K probably damaging Het
Sec23ip C T 7: 128,779,051 probably benign Het
Slc25a26 T A 6: 94,592,526 probably null Het
Slc6a7 A G 18: 61,002,111 probably benign Het
Slco6b1 A T 1: 96,987,837 noncoding transcript Het
Spata17 A G 1: 187,112,601 V111A probably damaging Het
Spata22 T A 11: 73,331,153 M1K probably null Het
Svep1 C T 4: 58,116,608 D881N possibly damaging Het
Sypl2 T A 3: 108,219,095 N67I possibly damaging Het
Tenm3 T C 8: 48,236,720 Y1944C probably damaging Het
Tm9sf4 G T 2: 153,195,313 V365L probably benign Het
Tmc3 T C 7: 83,607,742 V401A probably damaging Het
Trpm2 C T 10: 77,925,825 G997D probably damaging Het
Unc5b A T 10: 60,772,297 S675T probably damaging Het
Vmn1r217 A G 13: 23,113,937 M265T probably benign Het
Vps54 T A 11: 21,300,259 D548E probably benign Het
Wdfy3 A G 5: 101,917,411 V1297A probably benign Het
Wdr46 T A 17: 33,941,023 F70I probably benign Het
Zdbf2 C T 1: 63,304,006 Q515* probably null Het
Zfp710 T A 7: 80,081,973 C299* probably null Het
Other mutations in Olfr873
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02122:Olfr873 APN 9 20300584 missense probably damaging 1.00
IGL02268:Olfr873 APN 9 20300292 missense probably damaging 1.00
IGL02416:Olfr873 APN 9 20300245 missense probably benign 0.01
IGL03124:Olfr873 APN 9 20301163 missense probably benign 0.00
R0148:Olfr873 UTSW 9 20301091 missense probably damaging 1.00
R0266:Olfr873 UTSW 9 20301158 missense probably benign 0.01
R0831:Olfr873 UTSW 9 20300565 missense probably benign 0.20
R1456:Olfr873 UTSW 9 20300838 missense probably benign 0.35
R1894:Olfr873 UTSW 9 20300337 missense probably benign 0.23
R1928:Olfr873 UTSW 9 20301058 missense probably benign 0.12
R2135:Olfr873 UTSW 9 20300297 missense probably benign 0.00
R2379:Olfr873 UTSW 9 20300667 missense possibly damaging 0.87
R2911:Olfr873 UTSW 9 20300479 missense possibly damaging 0.60
R3788:Olfr873 UTSW 9 20300370 missense probably benign 0.13
R4657:Olfr873 UTSW 9 20300623 missense probably damaging 1.00
R5754:Olfr873 UTSW 9 20301094 missense probably damaging 1.00
R6291:Olfr873 UTSW 9 20300603 missense probably damaging 1.00
R6410:Olfr873 UTSW 9 20300452 missense probably damaging 1.00
R7014:Olfr873 UTSW 9 20300663 nonsense probably null
R7521:Olfr873 UTSW 9 20300740 missense not run
Predicted Primers PCR Primer
(F):5'- TGGGAGGTATAAAGCCTTCTCTACCTG -3'
(R):5'- TCATGACGTTGCAGTCATAAGCACC -3'

Sequencing Primer
(F):5'- CTGTGGGTCTCATCTGTCAG -3'
(R):5'- cttctttcagccttccctaattc -3'
Posted On2013-07-24