Mutagenetix > Incidental Mutation

Incidental Mutation 'R0521:Zic2'

66964

Institutional Source

Beutler Lab

Gene Symbol

Zic2

Ensembl Gene

ENSMUSG00000061524

Gene Name

zinc finger protein of the cerebellum 2

Synonyms

odd-paired homolog, GENA 29, Ku

MMRRC Submission

038714-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.899) question?

Stock #

R0521 (G1)

Quality Score

144

Status

Not validated

Chromosome

Chromosomal Location

122712847-122717264 bp(+) (GRCm39)

Type of Mutation

small deletion (2 aa in frame mutation)

DNA Base Change (assembly)

CCCACCACCACCATCACCACCACCACC to CCCACCATCACCACCACCACC at 122713776 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000075283 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075888]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000075888

SMART Domains

Protein: ENSMUSP00000075283
Gene: ENSMUSG00000061524

Domain	Start	End	E-Value	Type
low complexity region	18	33	N/A	INTRINSIC
low complexity region	81	103	N/A	INTRINSIC
low complexity region	131	150	N/A	INTRINSIC
low complexity region	215	241	N/A	INTRINSIC
ZnF_C2H2	265	290	5.68e1	SMART
ZnF_C2H2	299	326	6.92e0	SMART
ZnF_C2H2	332	356	8.02e-5	SMART
ZnF_C2H2	362	386	1.69e-3	SMART
ZnF_C2H2	392	414	4.54e-4	SMART
low complexity region	416	434	N/A	INTRINSIC
low complexity region	455	519	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135485

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137059

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177306

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. This protein functions as a transcriptional repressor and may regulate tissue specific expression of dopamine receptor D1. Expansion of an alanine repeat in the C-terminus of the encoded protein and other mutations in this gene cause holoprosencephaly type 5. Holoprosencephaly is the most common structural anomaly of the human brain. A polyhistidine tract polymorphism in this gene may be associated with increased risk of neural tube defects. This gene is closely linked to a gene encoding zinc finger protein of the cerebellum 5, a related family member on chromosome 13. [provided by RefSeq, Jul 2016]
PHENOTYPE: Defects in neurulation and forebrain development have been identified in both targeted and ENU induced homozygous mutants. Death occurs perinatally in the targeted mouse and during midgestation in the ENU mouse. Mice homozygous for a knock-down allele exhibit cognitive and social behavior defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl3	A	T	4: 144,182,464 (GRCm39)	S335T	probably damaging	Het
Abcb1b	G	A	5: 8,914,238 (GRCm39)	A1203T	probably damaging	Het
Acsbg3	T	A	17: 57,192,169 (GRCm39)	Y577*	probably null	Het
Agt	C	A	8: 125,283,839 (GRCm39)	E427*	probably null	Het
Angel1	G	A	12: 86,769,681 (GRCm39)	S193F	probably benign	Het
Ankrd16	T	C	2: 11,794,692 (GRCm39)	V359A	probably benign	Het
Ankrd33b	T	C	15: 31,367,432 (GRCm39)	D36G	probably damaging	Het
Ano8	A	T	8: 71,931,902 (GRCm39)	C766S	probably benign	Het
Asic1	C	T	15: 99,596,700 (GRCm39)	R499C	probably damaging	Het
Atpsckmt	T	G	15: 31,606,103 (GRCm39)	S20R	probably benign	Het
Bank1	C	T	3: 135,919,703 (GRCm39)	C364Y	probably damaging	Het
Bmerb1	T	A	16: 13,804,676 (GRCm39)	S8T	possibly damaging	Het
Bpifa5	C	A	2: 154,008,869 (GRCm39)	D223E	probably benign	Het
Capn5	C	T	7: 97,782,089 (GRCm39)	R217Q	probably damaging	Het
Ccm2	G	A	11: 6,540,886 (GRCm39)	S184N	probably damaging	Het
Ces5a	T	A	8: 94,252,286 (GRCm39)	D202V	probably damaging	Het
Clasrp	A	G	7: 19,322,528 (GRCm39)	I284T	probably benign	Het
Cog7	C	A	7: 121,540,392 (GRCm39)		probably null	Het
Col13a1	A	T	10: 61,698,525 (GRCm39)	M512K	unknown	Het
Cps1	A	C	1: 67,254,723 (GRCm39)	D1304A	probably benign	Het
Crhbp	C	A	13: 95,580,403 (GRCm39)		probably null	Het
Ctdspl2	T	A	2: 121,837,368 (GRCm39)	C377*	probably null	Het
Ctsl	G	A	13: 64,513,032 (GRCm39)	L297F	possibly damaging	Het
Ddost	A	G	4: 138,038,046 (GRCm39)	T262A	probably benign	Het
Ddx4	A	T	13: 112,761,313 (GRCm39)		probably null	Het
Ddx54	A	G	5: 120,764,927 (GRCm39)	I769V	probably benign	Het
Dock1	T	A	7: 134,745,507 (GRCm39)	I1463N	probably benign	Het
Dsg3	T	A	18: 20,660,872 (GRCm39)	Y404N	possibly damaging	Het
Epb42	T	A	2: 120,859,631 (GRCm39)	K186*	probably null	Het
Farp2	A	G	1: 93,504,543 (GRCm39)		probably null	Het
Fbxl9	A	T	8: 106,039,425 (GRCm39)	L617Q	probably damaging	Het
Fev	C	A	1: 74,921,692 (GRCm39)	R86L	possibly damaging	Het
Foxb2	G	T	19: 16,849,820 (GRCm39)	C395*	probably null	Het
Foxn3	A	G	12: 99,175,765 (GRCm39)	V261A	probably benign	Het
Fsd1	A	G	17: 56,298,245 (GRCm39)	D190G	probably benign	Het
Gm9930	A	T	10: 9,410,547 (GRCm39)		noncoding transcript	Het
Gsdma2	A	T	11: 98,545,727 (GRCm39)	K260*	probably null	Het
Hdac7	G	A	15: 97,704,380 (GRCm39)	Q497*	probably null	Het
Hic1	G	A	11: 75,057,713 (GRCm39)	P392L	possibly damaging	Het
Hk3	C	T	13: 55,162,239 (GRCm39)		probably null	Het
Ifna6	G	T	4: 88,745,887 (GRCm39)	V79F	probably benign	Het
Il20ra	A	T	10: 19,635,388 (GRCm39)	Q543L	probably damaging	Het
Itk	T	A	11: 46,251,115 (GRCm39)	D163V	probably damaging	Het
Kcnu1	T	G	8: 26,400,916 (GRCm39)	L688R	probably damaging	Het
Kdm5b	T	A	1: 134,545,771 (GRCm39)	S977R	possibly damaging	Het
Kng1	G	A	16: 22,879,232 (GRCm39)	A45T	possibly damaging	Het
Map1a	T	G	2: 121,136,234 (GRCm39)	L2350R	probably damaging	Het
Mdfic	A	G	6: 15,799,755 (GRCm39)	D212G	probably benign	Het
Ms4a1	C	A	19: 11,236,043 (GRCm39)		probably null	Het
Myo9a	T	A	9: 59,801,635 (GRCm39)	F1944L	probably damaging	Het
Nbea	A	T	3: 55,915,689 (GRCm39)	W928R	probably damaging	Het
Nfatc2ip	T	G	7: 125,995,751 (GRCm39)	D46A	possibly damaging	Het
Ngly1	C	T	14: 16,290,774 (GRCm38)	Q419*	probably null	Het
Nsd2	T	A	5: 34,000,682 (GRCm39)	N66K	probably damaging	Het
Nsmce4a	T	C	7: 130,138,732 (GRCm39)	H304R	probably damaging	Het
Odad2	G	A	18: 7,222,676 (GRCm39)	P531L	possibly damaging	Het
Or10a2	T	A	7: 106,673,965 (GRCm39)	L310Q	possibly damaging	Het
Or2y11	C	T	11: 49,443,291 (GRCm39)	T239M	probably damaging	Het
Or4a2	T	C	2: 89,248,544 (GRCm39)	Y71C	probably damaging	Het
Or51v8	T	A	7: 103,319,696 (GRCm39)	I181F	possibly damaging	Het
Or7e168	G	A	9: 19,720,156 (GRCm39)	V181I	probably benign	Het
Or8c20	A	C	9: 38,260,499 (GRCm39)	N40T	probably damaging	Het
Or8h9	C	T	2: 86,789,190 (GRCm39)	G204D	probably damaging	Het
Peg3	T	C	7: 6,714,427 (GRCm39)	E265G	probably damaging	Het
Pkd1	A	G	17: 24,814,193 (GRCm39)	S4188G	probably benign	Het
Pramel32	A	T	4: 88,547,559 (GRCm39)	N37K	probably damaging	Het
R3hdm1	G	A	1: 128,121,440 (GRCm39)	V315I	probably benign	Het
Rab24	A	T	13: 55,468,738 (GRCm39)		probably null	Het
Rap1gap2	A	T	11: 74,332,592 (GRCm39)	M71K	probably damaging	Het
Rergl	T	G	6: 139,473,524 (GRCm39)	K42T	probably damaging	Het
Septin5	T	C	16: 18,443,647 (GRCm39)	T92A	probably benign	Het
Setdb1	A	G	3: 95,246,140 (GRCm39)	V595A	probably benign	Het
Slc17a8	A	G	10: 89,412,192 (GRCm39)	S414P	probably benign	Het
Thnsl2	A	T	6: 71,111,243 (GRCm39)	D208E	probably damaging	Het
Tie1	A	C	4: 118,333,343 (GRCm39)	I841R	probably damaging	Het
Tll1	T	G	8: 64,551,505 (GRCm39)	D292A	probably damaging	Het
Tnfaip8l1	A	T	17: 56,478,727 (GRCm39)	T6S	probably damaging	Het
Trim17	T	A	11: 58,859,320 (GRCm39)	V178E	probably damaging	Het
Ttc27	A	T	17: 75,163,544 (GRCm39)	R717S	possibly damaging	Het
Upk2	G	T	9: 44,365,418 (GRCm39)	P50Q	probably damaging	Het
Usp9y	A	T	Y: 1,307,880 (GRCm39)	C2319S	probably benign	Het
Vmn2r100	A	T	17: 19,742,178 (GRCm39)	D184V	probably damaging	Het
Vmn2r9	C	A	5: 108,996,154 (GRCm39)	G165*	probably null	Het
Xkr6	A	T	14: 64,056,871 (GRCm39)	I261F	probably benign	Het
Xpnpep3	T	G	15: 81,311,693 (GRCm39)	I133S	possibly damaging	Het
Yipf1	A	G	4: 107,193,387 (GRCm39)	Y91C	probably benign	Het
Zfp442	T	C	2: 150,253,169 (GRCm39)	D31G	possibly damaging	Het
Zfp628	A	T	7: 4,922,939 (GRCm39)	Q387L	probably damaging	Het
Zfp804a	C	T	2: 82,089,761 (GRCm39)	Q1197*	probably null	Het

Other mutations in Zic2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00816:Zic2	APN	14	122,715,971 (GRCm39)	nonsense	probably null
IGL01607:Zic2	APN	14	122,716,294 (GRCm39)	splice site	probably benign
IGL02307:Zic2	APN	14	122,714,046 (GRCm39)	missense	possibly damaging	0.76
IGL02311:Zic2	APN	14	122,713,606 (GRCm39)	missense	probably damaging	0.99
IGL02561:Zic2	APN	14	122,715,957 (GRCm39)	nonsense	probably null
IGL02982:Zic2	APN	14	122,715,979 (GRCm39)	missense	probably damaging	0.98
R0001:Zic2	UTSW	14	122,716,369 (GRCm39)	missense	probably damaging	0.99
R0027:Zic2	UTSW	14	122,713,755 (GRCm39)	missense	possibly damaging	0.77
R0136:Zic2	UTSW	14	122,713,953 (GRCm39)	missense	probably damaging	0.96
R0310:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R0418:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R0420:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R0421:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R0518:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R0520:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R0628:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R1733:Zic2	UTSW	14	122,716,359 (GRCm39)	missense	probably damaging	0.97
R1757:Zic2	UTSW	14	122,716,031 (GRCm39)	missense	possibly damaging	0.86
R2398:Zic2	UTSW	14	122,716,329 (GRCm39)	nonsense	probably null
R5323:Zic2	UTSW	14	122,713,728 (GRCm39)	missense	probably damaging	1.00
R5381:Zic2	UTSW	14	122,713,227 (GRCm39)	missense	probably damaging	0.97
R6930:Zic2	UTSW	14	122,713,869 (GRCm39)	missense	probably damaging	0.99
R7223:Zic2	UTSW	14	122,713,503 (GRCm39)	missense	probably damaging	0.98
R8750:Zic2	UTSW	14	122,714,129 (GRCm39)	missense	probably benign	0.06
R8852:Zic2	UTSW	14	122,713,530 (GRCm39)	missense	possibly damaging	0.92
R8860:Zic2	UTSW	14	122,713,530 (GRCm39)	missense	possibly damaging	0.92
Z1088:Zic2	UTSW	14	122,716,087 (GRCm39)	missense	probably damaging	0.98

Predicted Primers

Posted On

2013-08-19