Incidental Mutation 'R0741:Nr2f2'
ID70686
Institutional Source Beutler Lab
Gene Symbol Nr2f2
Ensembl Gene ENSMUSG00000030551
Gene Namenuclear receptor subfamily 2, group F, member 2
SynonymsTcfcoup2, COUP-TFII, COUP-TF2, ARP-1, EAR3, 9430015G03Rik, Aporp1
MMRRC Submission 038922-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0741 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location70351944-70366735 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 70357997 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 113 (R113C)
Ref Sequence ENSEMBL: ENSMUSP00000086993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032768] [ENSMUST00000089565] [ENSMUST00000208081]
Predicted Effect probably damaging
Transcript: ENSMUST00000032768
AA Change: R246C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032768
Gene: ENSMUSG00000030551
AA Change: R246C

DomainStartEndE-ValueType
low complexity region 21 75 N/A INTRINSIC
ZnF_C4 76 147 4.57e-39 SMART
HOLI 214 374 1.29e-47 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000089565
AA Change: R113C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086993
Gene: ENSMUSG00000030551
AA Change: R113C

DomainStartEndE-ValueType
HOLI 81 241 5.2e-50 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207153
Predicted Effect probably benign
Transcript: ENSMUST00000208081
AA Change: R93C

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208474
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208681
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the steroid thyroid hormone superfamily of nuclear receptors. The encoded protein is a ligand inducible transcription factor that is involved in the regulation of many different genes. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired angiogenesis and heart development with hemorrhagic brains and hearts, and die around embryonic day 10. About 5% of heterozygotes share the hemorrhagic phenotype at embryonic day 9.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano7 T A 1: 93,401,587 I701N probably damaging Het
Asb7 A T 7: 66,660,134 N111K probably benign Het
Atp10a T A 7: 58,828,589 L1460Q possibly damaging Het
Auh T C 13: 52,929,602 T14A possibly damaging Het
Caskin2 A G 11: 115,804,800 V245A probably damaging Het
Cryba4 G A 5: 112,246,688 R192C probably damaging Het
Ctsq T A 13: 61,036,205 D301V probably damaging Het
Dpyd A G 3: 118,674,505 E56G possibly damaging Het
Dtd2 T C 12: 51,999,672 K128R probably benign Het
Eps8l3 A G 3: 107,882,825 T141A probably benign Het
Evc A T 5: 37,326,395 I187N possibly damaging Het
Fam120a A G 13: 48,891,940 S807P possibly damaging Het
Fbxw22 G A 9: 109,382,219 S338L probably benign Het
Gcnt4 G T 13: 96,946,432 E79* probably null Het
Get4 G A 5: 139,263,629 probably benign Het
Hipk1 A G 3: 103,746,812 V954A probably benign Het
Ifi206 C T 1: 173,473,749 V788M probably benign Het
Iqgap1 A G 7: 80,720,987 S1545P probably benign Het
Kif21b A G 1: 136,159,744 T933A probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Magee2 A G X: 104,855,866 L393P probably damaging Het
Mtrr T C 13: 68,579,539 probably null Het
Nes A G 3: 87,978,967 E1467G probably damaging Het
Nol3 C G 8: 105,279,124 A50G probably damaging Het
Obscn CCACACACACACAC CCACACACACAC 11: 59,063,453 probably null Het
Olfr512 T A 7: 108,713,604 C84S probably benign Het
Pnkd T A 1: 74,351,859 S337R possibly damaging Het
Ptprh A G 7: 4,554,173 probably null Het
Ralgapa1 A C 12: 55,676,581 V1767G probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Skap1 A C 11: 96,492,933 probably benign Het
Trip12 A G 1: 84,745,181 S1250P probably benign Het
Txndc5 T C 13: 38,528,260 H50R possibly damaging Het
Usp25 C A 16: 77,071,708 D332E possibly damaging Het
Vgll1 A T X: 57,096,284 probably benign Het
Other mutations in Nr2f2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Nr2f2 APN 7 70357766 missense possibly damaging 0.88
IGL01736:Nr2f2 APN 7 70354698 missense probably damaging 1.00
IGL02667:Nr2f2 APN 7 70357985 missense probably damaging 1.00
R0149:Nr2f2 UTSW 7 70358062 missense possibly damaging 0.90
R0206:Nr2f2 UTSW 7 70360175 missense probably damaging 0.98
R0207:Nr2f2 UTSW 7 70360175 missense probably damaging 0.98
R0240:Nr2f2 UTSW 7 70360175 missense probably damaging 0.98
R0243:Nr2f2 UTSW 7 70360175 missense probably damaging 0.98
R0361:Nr2f2 UTSW 7 70358062 missense possibly damaging 0.90
R0540:Nr2f2 UTSW 7 70354712 missense probably damaging 1.00
R0607:Nr2f2 UTSW 7 70354712 missense probably damaging 1.00
R1894:Nr2f2 UTSW 7 70354671 missense probably benign 0.00
R1961:Nr2f2 UTSW 7 70358155 missense possibly damaging 0.80
R3033:Nr2f2 UTSW 7 70358062 missense possibly damaging 0.90
R3754:Nr2f2 UTSW 7 70358021 missense probably benign 0.01
R4517:Nr2f2 UTSW 7 70358122 missense probably benign 0.21
R6175:Nr2f2 UTSW 7 70358198 missense probably damaging 1.00
R6226:Nr2f2 UTSW 7 70359996 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCTGAGGTGAACAGGACTATGGC -3'
(R):5'- GCGGGACCAAGGCTGATCATTAAC -3'

Sequencing Primer
(F):5'- TTGAGGCAGCTATACTCGGC -3'
(R):5'- AGTTTGCCCTGACCAACG -3'
Posted On2013-09-30