Incidental Mutation 'R0831:Olfr273'
ID77525
Institutional Source Beutler Lab
Gene Symbol Olfr273
Ensembl Gene ENSMUSG00000049648
Gene Nameolfactory receptor 273
SynonymsGA_x6K02T2N78B-7137430-7138383, MOR262-8
MMRRC Submission 039010-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R0831 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location52852154-52859236 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 52855764 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 250 (I250L)
Ref Sequence ENSEMBL: ENSMUSP00000149869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051520] [ENSMUST00000107670] [ENSMUST00000215274]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051520
AA Change: I250L

PolyPhen 2 Score 0.464 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000052080
Gene: ENSMUSG00000049648
AA Change: I250L

DomainStartEndE-ValueType
Pfam:7tm_4 31 314 1.3e-55 PFAM
Pfam:7tm_1 41 296 1.4e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107670
AA Change: I250L

PolyPhen 2 Score 0.464 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103297
Gene: ENSMUSG00000049648
AA Change: I250L

DomainStartEndE-ValueType
Pfam:7tm_1 41 296 3.2e-37 PFAM
Pfam:7tm_4 139 289 4e-42 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215274
AA Change: I250L

PolyPhen 2 Score 0.464 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.28 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.0%
Validation Efficiency 95% (82/86)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,269,779 H292R possibly damaging Het
2900092C05Rik C T 7: 12,550,596 probably benign Het
3425401B19Rik T C 14: 32,662,271 N579S probably benign Het
A530032D15Rik C G 1: 85,099,505 K113N probably benign Het
Adck1 G T 12: 88,368,348 M1I probably null Het
Adgra3 A T 5: 49,970,802 I779N probably damaging Het
Adgrf2 A G 17: 42,710,443 S497P probably damaging Het
Afg3l2 A C 18: 67,421,227 F468L probably damaging Het
Alms1 T A 6: 85,628,520 I2384N probably benign Het
Ankrd13b A T 11: 77,472,759 S244R probably damaging Het
Aox2 T A 1: 58,339,683 H1030Q probably benign Het
Ap1b1 A G 11: 5,023,092 probably benign Het
Atxn2l A G 7: 126,499,160 S187P probably damaging Het
B4galt4 G T 16: 38,767,979 E57D probably benign Het
Cad T C 5: 31,067,600 V949A probably damaging Het
Cadps2 C T 6: 23,321,740 S1051N possibly damaging Het
Ccdc66 C T 14: 27,497,356 V148I probably benign Het
Ccser1 C T 6: 61,423,061 P55S probably damaging Het
Cds2 T C 2: 132,285,967 probably null Het
Cep95 A G 11: 106,814,704 D548G probably benign Het
Chil3 A G 3: 106,149,747 Y294H probably benign Het
Chmp5 A G 4: 40,949,500 D39G probably damaging Het
Chrd T A 16: 20,741,309 F887I probably damaging Het
Col24a1 G T 3: 145,328,759 G580V probably damaging Het
Col6a2 A T 10: 76,604,105 N655K probably damaging Het
Ctsf A T 19: 4,859,840 Y416F possibly damaging Het
Dennd5a A C 7: 109,934,754 V77G probably damaging Het
Dna2 A T 10: 62,959,329 K460* probably null Het
Dnah17 A T 11: 118,060,271 M2842K probably damaging Het
Dnajc13 C A 9: 104,172,612 G1765V probably damaging Het
Donson A C 16: 91,683,763 C243W probably damaging Het
Dpp8 A T 9: 65,078,679 N817I possibly damaging Het
Eef1d G A 15: 75,896,806 probably benign Het
Esf1 T A 2: 140,168,359 D19V probably damaging Het
Gm21738 T A 14: 19,415,957 Y194F probably benign Het
Gm21738 T C 14: 19,415,963 K192R probably benign Het
Gm9867 C A 4: 140,322,488 A128S unknown Het
Igsf23 G T 7: 19,941,737 probably benign Het
Kdm7a C A 6: 39,166,765 probably benign Het
Kif14 G A 1: 136,525,871 probably benign Het
Mroh7 T C 4: 106,680,793 N1229D possibly damaging Het
Mrps11 C A 7: 78,791,863 probably benign Het
Mtmr2 T A 9: 13,796,113 D248E probably damaging Het
Myrfl C A 10: 116,783,209 S748I probably benign Het
Nop14 T C 5: 34,650,520 E366G possibly damaging Het
Olfr225 C T 11: 59,613,654 T230I possibly damaging Het
Olfr618 A G 7: 103,598,131 I272V probably benign Het
Olfr873 T A 9: 20,300,565 C123S probably benign Het
Olfr971 C T 9: 39,840,283 P283L probably damaging Het
Phykpl G T 11: 51,585,539 E29* probably null Het
Plppr4 A G 3: 117,331,646 probably null Het
Prmt2 A C 10: 76,207,807 probably benign Het
Prodh2 T A 7: 30,494,224 Y114* probably null Het
Prr23a2 C A 9: 98,856,864 H92N probably damaging Het
Rasl10b G A 11: 83,417,839 probably null Het
Rdx C A 9: 52,065,817 A122E probably damaging Het
Rspo3 T G 10: 29,454,257 D236A unknown Het
Sdk2 A T 11: 113,832,258 D1302E probably damaging Het
Sipa1 A T 19: 5,660,354 D209E probably damaging Het
Sirpa T G 2: 129,627,936 probably benign Het
Ska1 A C 18: 74,197,499 probably benign Het
Slc4a9 T C 18: 36,535,278 probably benign Het
Slco1b2 T C 6: 141,685,446 V602A probably benign Het
Slco2a1 T C 9: 103,082,334 V543A probably damaging Het
Sorcs3 A T 19: 48,693,994 L489F probably damaging Het
Sorl1 T C 9: 42,071,069 probably benign Het
Spindoc G T 19: 7,374,735 N82K probably benign Het
Stk17b C A 1: 53,757,492 C372F probably damaging Het
Tbck A G 3: 132,722,291 probably benign Het
Thoc1 C T 18: 9,963,267 T127I probably benign Het
Togaram2 G T 17: 71,716,444 R765L probably damaging Het
Tprg A G 16: 25,317,469 Y70C probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Umodl1 T C 17: 30,996,351 Y1050H probably damaging Het
Vmn1r205 T A 13: 22,592,416 D172V probably benign Het
Vmn1r79 A T 7: 12,177,063 N291Y probably damaging Het
Vmn2r112 T A 17: 22,614,999 N549K probably damaging Het
Vrk3 T A 7: 44,764,803 L241Q probably damaging Het
Zc3h7a A G 16: 11,151,880 S386P probably damaging Het
Other mutations in Olfr273
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02114:Olfr273 APN 4 52856144 missense probably damaging 1.00
R0048:Olfr273 UTSW 4 52856196 missense probably damaging 1.00
R0048:Olfr273 UTSW 4 52856196 missense probably damaging 1.00
R0826:Olfr273 UTSW 4 52855566 missense probably benign
R1772:Olfr273 UTSW 4 52855730 missense probably benign 0.30
R1774:Olfr273 UTSW 4 52855674 missense probably benign 0.01
R1861:Olfr273 UTSW 4 52856373 missense probably benign 0.00
R2080:Olfr273 UTSW 4 52855568 missense probably benign 0.20
R2242:Olfr273 UTSW 4 52855769 missense probably damaging 1.00
R3777:Olfr273 UTSW 4 52855636 missense probably damaging 1.00
R4492:Olfr273 UTSW 4 52855764 missense probably benign 0.01
R4748:Olfr273 UTSW 4 52856076 missense possibly damaging 0.95
R4880:Olfr273 UTSW 4 52856411 missense probably damaging 1.00
R4905:Olfr273 UTSW 4 52855613 missense probably damaging 0.99
R5856:Olfr273 UTSW 4 52856516 start gained probably benign
R6585:Olfr273 UTSW 4 52856192 missense possibly damaging 0.84
R6862:Olfr273 UTSW 4 52855695 missense probably benign
R7378:Olfr273 UTSW 4 52856421 missense probably benign
Predicted Primers PCR Primer
(F):5'- AACCTGTGTTTGCTGATGTCTCTAAGG -3'
(R):5'- TCATGGTTCTCTGGCAGCATCAATTC -3'

Sequencing Primer
(F):5'- GATGTCTCTAAGGAACGTACTTTTG -3'
(R):5'- GAGGTCTTAGCTGTCCTCAAGC -3'
Posted On2013-10-16