Incidental Mutation 'R0831:Adgrf2'
ID77585
Institutional Source Beutler Lab
Gene Symbol Adgrf2
Ensembl Gene ENSMUSG00000057899
Gene Nameadhesion G protein-coupled receptor F2
SynonymsGpr111, PGR20
MMRRC Submission 039010-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0831 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location42708936-42742179 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42710443 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 497 (S497P)
Ref Sequence ENSEMBL: ENSMUSP00000109244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113614]
Predicted Effect probably damaging
Transcript: ENSMUST00000113614
AA Change: S497P

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109244
Gene: ENSMUSG00000057899
AA Change: S497P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
GPS 325 376 2.05e-4 SMART
Pfam:7tm_2 378 625 4.1e-29 PFAM
Meta Mutation Damage Score 0.04 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.0%
Validation Efficiency 95% (82/86)
MGI Phenotype PHENOTYPE: Mice homozygous for a reporter allele exhibit normal viability and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,269,779 H292R possibly damaging Het
2900092C05Rik C T 7: 12,550,596 probably benign Het
3425401B19Rik T C 14: 32,662,271 N579S probably benign Het
A530032D15Rik C G 1: 85,099,505 K113N probably benign Het
Adck1 G T 12: 88,368,348 M1I probably null Het
Adgra3 A T 5: 49,970,802 I779N probably damaging Het
Afg3l2 A C 18: 67,421,227 F468L probably damaging Het
Alms1 T A 6: 85,628,520 I2384N probably benign Het
Ankrd13b A T 11: 77,472,759 S244R probably damaging Het
Aox2 T A 1: 58,339,683 H1030Q probably benign Het
Ap1b1 A G 11: 5,023,092 probably benign Het
Atxn2l A G 7: 126,499,160 S187P probably damaging Het
B4galt4 G T 16: 38,767,979 E57D probably benign Het
Cad T C 5: 31,067,600 V949A probably damaging Het
Cadps2 C T 6: 23,321,740 S1051N possibly damaging Het
Ccdc66 C T 14: 27,497,356 V148I probably benign Het
Ccser1 C T 6: 61,423,061 P55S probably damaging Het
Cds2 T C 2: 132,285,967 probably null Het
Cep95 A G 11: 106,814,704 D548G probably benign Het
Chil3 A G 3: 106,149,747 Y294H probably benign Het
Chmp5 A G 4: 40,949,500 D39G probably damaging Het
Chrd T A 16: 20,741,309 F887I probably damaging Het
Col24a1 G T 3: 145,328,759 G580V probably damaging Het
Col6a2 A T 10: 76,604,105 N655K probably damaging Het
Ctsf A T 19: 4,859,840 Y416F possibly damaging Het
Dennd5a A C 7: 109,934,754 V77G probably damaging Het
Dna2 A T 10: 62,959,329 K460* probably null Het
Dnah17 A T 11: 118,060,271 M2842K probably damaging Het
Dnajc13 C A 9: 104,172,612 G1765V probably damaging Het
Donson A C 16: 91,683,763 C243W probably damaging Het
Dpp8 A T 9: 65,078,679 N817I possibly damaging Het
Eef1d G A 15: 75,896,806 probably benign Het
Esf1 T A 2: 140,168,359 D19V probably damaging Het
Gm21738 T A 14: 19,415,957 Y194F probably benign Het
Gm21738 T C 14: 19,415,963 K192R probably benign Het
Gm9867 C A 4: 140,322,488 A128S unknown Het
Igsf23 G T 7: 19,941,737 probably benign Het
Kdm7a C A 6: 39,166,765 probably benign Het
Kif14 G A 1: 136,525,871 probably benign Het
Mroh7 T C 4: 106,680,793 N1229D possibly damaging Het
Mrps11 C A 7: 78,791,863 probably benign Het
Mtmr2 T A 9: 13,796,113 D248E probably damaging Het
Myrfl C A 10: 116,783,209 S748I probably benign Het
Nop14 T C 5: 34,650,520 E366G possibly damaging Het
Olfr225 C T 11: 59,613,654 T230I possibly damaging Het
Olfr273 T G 4: 52,855,764 I250L possibly damaging Het
Olfr618 A G 7: 103,598,131 I272V probably benign Het
Olfr873 T A 9: 20,300,565 C123S probably benign Het
Olfr971 C T 9: 39,840,283 P283L probably damaging Het
Phykpl G T 11: 51,585,539 E29* probably null Het
Plppr4 A G 3: 117,331,646 probably null Het
Prmt2 A C 10: 76,207,807 probably benign Het
Prodh2 T A 7: 30,494,224 Y114* probably null Het
Prr23a2 C A 9: 98,856,864 H92N probably damaging Het
Rasl10b G A 11: 83,417,839 probably null Het
Rdx C A 9: 52,065,817 A122E probably damaging Het
Rspo3 T G 10: 29,454,257 D236A unknown Het
Sdk2 A T 11: 113,832,258 D1302E probably damaging Het
Sipa1 A T 19: 5,660,354 D209E probably damaging Het
Sirpa T G 2: 129,627,936 probably benign Het
Ska1 A C 18: 74,197,499 probably benign Het
Slc4a9 T C 18: 36,535,278 probably benign Het
Slco1b2 T C 6: 141,685,446 V602A probably benign Het
Slco2a1 T C 9: 103,082,334 V543A probably damaging Het
Sorcs3 A T 19: 48,693,994 L489F probably damaging Het
Sorl1 T C 9: 42,071,069 probably benign Het
Spindoc G T 19: 7,374,735 N82K probably benign Het
Stk17b C A 1: 53,757,492 C372F probably damaging Het
Tbck A G 3: 132,722,291 probably benign Het
Thoc1 C T 18: 9,963,267 T127I probably benign Het
Togaram2 G T 17: 71,716,444 R765L probably damaging Het
Tprg A G 16: 25,317,469 Y70C probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Umodl1 T C 17: 30,996,351 Y1050H probably damaging Het
Vmn1r205 T A 13: 22,592,416 D172V probably benign Het
Vmn1r79 A T 7: 12,177,063 N291Y probably damaging Het
Vmn2r112 T A 17: 22,614,999 N549K probably damaging Het
Vrk3 T A 7: 44,764,803 L241Q probably damaging Het
Zc3h7a A G 16: 11,151,880 S386P probably damaging Het
Other mutations in Adgrf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Adgrf2 APN 17 42714315 splice site probably benign
IGL01089:Adgrf2 APN 17 42710158 missense probably damaging 1.00
IGL01601:Adgrf2 APN 17 42710049 missense probably benign
IGL01765:Adgrf2 APN 17 42719535 missense probably benign 0.06
IGL02946:Adgrf2 APN 17 42710493 missense probably damaging 1.00
R0498:Adgrf2 UTSW 17 42714315 splice site probably benign
R0720:Adgrf2 UTSW 17 42713172 missense probably damaging 1.00
R1664:Adgrf2 UTSW 17 42714414 missense possibly damaging 0.92
R2008:Adgrf2 UTSW 17 42710122 missense probably damaging 0.96
R2306:Adgrf2 UTSW 17 42713119 missense possibly damaging 0.92
R2519:Adgrf2 UTSW 17 42710407 missense probably damaging 1.00
R3713:Adgrf2 UTSW 17 42713088 missense probably damaging 1.00
R3736:Adgrf2 UTSW 17 42711012 missense probably benign 0.32
R4272:Adgrf2 UTSW 17 42710122 missense probably damaging 0.99
R4273:Adgrf2 UTSW 17 42710122 missense probably damaging 0.99
R4422:Adgrf2 UTSW 17 42713155 missense probably benign
R4732:Adgrf2 UTSW 17 42710754 missense probably damaging 1.00
R4733:Adgrf2 UTSW 17 42710754 missense probably damaging 1.00
R4906:Adgrf2 UTSW 17 42711193 missense probably benign
R5053:Adgrf2 UTSW 17 42710443 missense probably damaging 0.96
R5078:Adgrf2 UTSW 17 42710986 missense probably damaging 1.00
R5089:Adgrf2 UTSW 17 42710097 missense probably benign 0.00
R5147:Adgrf2 UTSW 17 42710683 missense probably damaging 0.99
R5953:Adgrf2 UTSW 17 42710338 missense probably damaging 1.00
R5968:Adgrf2 UTSW 17 42715172 critical splice donor site probably null
R6791:Adgrf2 UTSW 17 42710883 missense probably benign 0.02
R7138:Adgrf2 UTSW 17 42710983 missense probably damaging 1.00
X0061:Adgrf2 UTSW 17 42713074 missense probably benign 0.37
X0067:Adgrf2 UTSW 17 42710668 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACGATGGCTCTTACTTCCTGGAAC -3'
(R):5'- GCCCAGTACTACACCACAATGGATG -3'

Sequencing Primer
(F):5'- TTCCTGGAACATGGAACTACCG -3'
(R):5'- CACCACAATGGATGTGTGGC -3'
Posted On2013-10-16