Incidental Mutation 'R0853:Vezf1'
ID82625
Institutional Source Beutler Lab
Gene Symbol Vezf1
Ensembl Gene ENSMUSG00000018377
Gene Namevascular endothelial zinc finger 1
Synonymsdb1
MMRRC Submission 039032-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0853 (G1)
Quality Score130
Status Not validated
Chromosome11
Chromosomal Location88068279-88084729 bp(+) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) A to T at 88068435 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000018521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018521]
Predicted Effect probably benign
Transcript: ENSMUST00000018521
SMART Domains Protein: ENSMUSP00000018521
Gene: ENSMUSG00000018377

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
ZnF_C2H2 74 96 3.83e-2 SMART
low complexity region 137 172 N/A INTRINSIC
ZnF_C2H2 174 196 6.78e-3 SMART
ZnF_C2H2 202 224 2.99e-4 SMART
ZnF_C2H2 232 255 1.1e-2 SMART
ZnF_C2H2 261 283 3.16e-3 SMART
ZnF_C2H2 287 308 2.61e1 SMART
low complexity region 335 351 N/A INTRINSIC
low complexity region 368 379 N/A INTRINSIC
low complexity region 384 397 N/A INTRINSIC
low complexity region 454 472 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153213
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156149
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.9%
Validation Efficiency 93% (42/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transcriptional regulatory proteins containing tandemly repeated zinc finger domains are thought to be involved in both normal and abnormal cellular proliferation and differentiation. ZNF161 is a C2H2-type zinc finger protein (Koyano-Nakagawa et al., 1994 [PubMed 8035792]). See MIM 603971 for general information on zinc finger proteins.[supplied by OMIM, Sep 2008]
PHENOTYPE: Homozygous null mice die at midgestation due to angiogenic remodeling defects and loss of vascular integrity leading to hemorrhaging in the head, heart and trunk. One fifth of heterozygous null embryos show lymphatic hypervascularization associated with hemorrhaging and edema in the jugular region. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amotl1 G T 9: 14,592,778 P378Q probably damaging Het
Angpt4 A G 2: 151,938,927 E365G probably damaging Het
Asb6 G A 2: 30,827,030 P61L possibly damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Atxn7 C A 14: 14,089,465 probably benign Het
Cacul1 A T 19: 60,534,226 I290N probably damaging Het
Ccser2 A C 14: 36,940,410 S272R probably benign Het
Cfh T A 1: 140,105,490 H772L probably damaging Het
Cldn6 T G 17: 23,681,464 I134S probably damaging Het
Col3a1 T A 1: 45,343,324 probably benign Het
Fam118a T C 15: 85,048,525 F156S possibly damaging Het
Fgd4 T A 16: 16,474,387 probably benign Het
Gckr G C 5: 31,305,048 A242P probably damaging Het
Gcnt4 A G 13: 96,946,835 D213G probably damaging Het
Gm21994 A T 2: 150,255,478 S38R probably benign Het
Hace1 T A 10: 45,648,683 V237E probably damaging Het
Herc3 T C 6: 58,876,564 L570P probably damaging Het
Hk1 T A 10: 62,271,716 K827* probably null Het
Hyal6 T C 6: 24,734,073 F2L probably benign Het
Jak2 C A 19: 29,284,926 Y382* probably null Het
Kat8 C T 7: 127,925,224 H425Y probably benign Het
Kcnj3 T C 2: 55,437,223 F8S possibly damaging Het
Klk1 T A 7: 44,221,498 probably benign Het
Klra8 T C 6: 130,119,014 Y205C probably damaging Het
Kpnb1 T C 11: 97,187,411 E26G probably damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nphp3 T C 9: 104,031,933 S781P probably benign Het
Nqo2 A T 13: 33,979,577 H73L probably benign Het
P3h3 G T 6: 124,854,933 D296E probably benign Het
Pah G A 10: 87,576,218 probably null Het
Pcdhb4 T G 18: 37,309,885 Y749* probably null Het
Pdgfrb C A 18: 61,080,327 N914K probably damaging Het
Ralyl A G 3: 13,946,506 Y4C probably damaging Het
Rapgef6 T A 11: 54,668,677 I1052N probably damaging Het
Sdk2 G A 11: 113,821,415 T1642I probably benign Het
Siglec1 G A 2: 131,085,022 T207M probably damaging Het
Taf1b T C 12: 24,514,828 L148P probably benign Het
Tbx20 A G 9: 24,725,612 M393T probably benign Het
Tdp1 G A 12: 99,935,067 R536H probably damaging Het
Tubgcp5 T A 7: 55,814,851 probably benign Het
Vmn1r58 G T 7: 5,410,325 T302K probably damaging Het
Other mutations in Vezf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Vezf1 APN 11 88073494 missense probably benign 0.14
IGL00576:Vezf1 APN 11 88073644 nonsense probably null
IGL02683:Vezf1 APN 11 88076327 missense probably benign 0.36
IGL02700:Vezf1 APN 11 88073303 missense probably damaging 0.97
IGL02701:Vezf1 APN 11 88076221 nonsense probably null
R0541:Vezf1 UTSW 11 88081577 missense possibly damaging 0.77
R0591:Vezf1 UTSW 11 88068435 critical splice donor site probably benign
R0592:Vezf1 UTSW 11 88068435 critical splice donor site probably benign
R0725:Vezf1 UTSW 11 88073330 missense probably benign 0.04
R0758:Vezf1 UTSW 11 88068435 critical splice donor site probably benign
R0803:Vezf1 UTSW 11 88068435 critical splice donor site probably benign
R0854:Vezf1 UTSW 11 88068435 critical splice donor site probably benign
R1491:Vezf1 UTSW 11 88073747 missense probably damaging 1.00
R1605:Vezf1 UTSW 11 88076299 missense possibly damaging 0.75
R1781:Vezf1 UTSW 11 88081621 missense probably benign 0.28
R3898:Vezf1 UTSW 11 88076173 missense probably benign
R4656:Vezf1 UTSW 11 88074667 missense probably damaging 1.00
R4868:Vezf1 UTSW 11 88074694 missense probably damaging 1.00
R5946:Vezf1 UTSW 11 88073734 nonsense probably null
R6190:Vezf1 UTSW 11 88076186 missense probably benign 0.02
R6258:Vezf1 UTSW 11 88081500 missense probably damaging 1.00
R6260:Vezf1 UTSW 11 88081500 missense probably damaging 1.00
R6452:Vezf1 UTSW 11 88081670 missense possibly damaging 0.66
R6680:Vezf1 UTSW 11 88081584 missense probably benign 0.23
R6983:Vezf1 UTSW 11 88073319 missense possibly damaging 0.88
R7086:Vezf1 UTSW 11 88078538 missense probably benign 0.00
R7322:Vezf1 UTSW 11 88081584 missense possibly damaging 0.68
R7443:Vezf1 UTSW 11 88074663 missense probably damaging 1.00
X0019:Vezf1 UTSW 11 88068435 critical splice donor site probably benign
X0067:Vezf1 UTSW 11 88081728 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- TCCCGGAGGTTACCGGAAGTGG -3'
(R):5'- TGGCGGCGAAGCCAGAGATACC -3'

Sequencing Primer
(F):5'- GCTGCCATGTTGAGGAgc -3'
(R):5'- AGGGTCAGAAAGTCAACACAC -3'
Posted On2013-11-08