Incidental Mutation 'R1290:St6gal1'
ID150770
Institutional Source Beutler Lab
Gene Symbol St6gal1
Ensembl Gene ENSMUSG00000022885
Gene Namebeta galactoside alpha 2,6 sialyltransferase 1
SynonymsSt6Gal-I, Siat1, ST6Gal I
MMRRC Submission 039356-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R1290 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location23224740-23360350 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23321661 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 194 (Q194R)
Ref Sequence ENSEMBL: ENSMUSP00000136206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023601] [ENSMUST00000115335] [ENSMUST00000128050] [ENSMUST00000178797]
Predicted Effect probably benign
Transcript: ENSMUST00000023601
AA Change: Q194R

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000023601
Gene: ENSMUSG00000022885
AA Change: Q194R

DomainStartEndE-ValueType
transmembrane domain 9 26 N/A INTRINSIC
Pfam:Glyco_transf_29 127 389 2.3e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115335
AA Change: Q194R

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000110992
Gene: ENSMUSG00000022885
AA Change: Q194R

DomainStartEndE-ValueType
transmembrane domain 9 26 N/A INTRINSIC
Pfam:Glyco_transf_29 140 383 8.3e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152449
Predicted Effect probably benign
Transcript: ENSMUST00000178797
AA Change: Q194R

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000136206
Gene: ENSMUSG00000022885
AA Change: Q194R

DomainStartEndE-ValueType
transmembrane domain 9 26 N/A INTRINSIC
Pfam:Glyco_transf_29 127 389 2.3e-63 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of glycosyltransferase family 29. The encoded protein is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to galactose-containing substrates. The protein, which is normally found in the Golgi but can be proteolytically processed to a soluble form, is involved in the generation of the cell-surface carbohydrate determinants and differentiation antigens HB-6, CD75, and CD76. This gene has been incorrectly referred to as CD75. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on chromosome 15. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutation of this gene results in altered terminal glycosylation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfrp1 C T 2: 181,364,604 probably null Het
Borcs5 A G 6: 134,644,368 D34G possibly damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Efl1 T C 7: 82,671,728 V123A probably damaging Het
Exd2 T A 12: 80,484,326 L99Q probably benign Het
Fnip2 T C 3: 79,465,693 D1026G probably damaging Het
Gprin3 A G 6: 59,354,464 F286S possibly damaging Het
Gramd1b A G 9: 40,316,821 probably null Het
Ints1 A T 5: 139,771,410 L417* probably null Het
Iqgap2 A T 13: 95,668,513 V845E probably damaging Het
Kcnh3 G A 15: 99,227,120 probably null Het
Mbd1 T C 18: 74,269,486 S20P possibly damaging Het
Mef2c A T 13: 83,662,359 T375S probably benign Het
Mmp16 A T 4: 18,051,725 N238I probably damaging Het
Neurod2 A T 11: 98,327,288 V350E possibly damaging Het
P3h2 C T 16: 25,987,203 E297K probably damaging Het
Pcdhb1 A G 18: 37,265,230 H78R possibly damaging Het
Slc22a14 A C 9: 119,178,452 L297R probably damaging Het
Slc22a8 G A 19: 8,609,911 G445D probably damaging Het
Spink5 A G 18: 44,007,711 D659G probably damaging Het
Tas2r104 A T 6: 131,684,845 C300* probably null Het
Ttc6 G A 12: 57,660,413 S702N probably benign Het
Wnk4 C G 11: 101,276,340 probably benign Het
Zfyve28 A T 5: 34,198,801 D785E probably benign Het
Other mutations in St6gal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:St6gal1 APN 16 23356392 splice site probably benign
IGL01667:St6gal1 APN 16 23321424 missense probably benign 0.00
IGL01783:St6gal1 APN 16 23321555 missense probably benign 0.29
IGL02996:St6gal1 APN 16 23321154 missense probably damaging 0.98
R0049:St6gal1 UTSW 16 23321141 missense probably damaging 1.00
R0049:St6gal1 UTSW 16 23321141 missense probably damaging 1.00
R0295:St6gal1 UTSW 16 23356203 splice site probably benign
R1352:St6gal1 UTSW 16 23321651 missense probably damaging 1.00
R1817:St6gal1 UTSW 16 23321333 nonsense probably null
R1911:St6gal1 UTSW 16 23321633 missense probably damaging 0.99
R2113:St6gal1 UTSW 16 23328417 missense probably damaging 0.98
R4591:St6gal1 UTSW 16 23321294 missense probably benign 0.00
R5761:St6gal1 UTSW 16 23321055 utr 5 prime probably benign
R6554:St6gal1 UTSW 16 23321655 missense probably benign 0.00
R6925:St6gal1 UTSW 16 23356213 missense probably damaging 1.00
R7658:St6gal1 UTSW 16 23356228 missense probably damaging 1.00
R7740:St6gal1 UTSW 16 23321035 splice site probably benign
R8017:St6gal1 UTSW 16 23357835 missense probably benign 0.01
R8018:St6gal1 UTSW 16 23357835 missense probably benign 0.01
R8019:St6gal1 UTSW 16 23357835 missense probably benign 0.01
R8044:St6gal1 UTSW 16 23357835 missense probably benign 0.01
R8122:St6gal1 UTSW 16 23354894 missense probably benign 0.00
R8123:St6gal1 UTSW 16 23357835 missense probably benign 0.01
R8124:St6gal1 UTSW 16 23357835 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GACCAGGAGTCAAGTTCAGCGTAG -3'
(R):5'- AATTCCCCAGTCAATCCTCGGACG -3'

Sequencing Primer
(F):5'- TCAAGTTCAGCGTAGAGGCG -3'
(R):5'- tgagcaagccagtaagcag -3'
Posted On2014-01-29