Incidental Mutation 'R1290:Gprin3'
ID150755
Institutional Source Beutler Lab
Gene Symbol Gprin3
Ensembl Gene ENSMUSG00000045441
Gene NameGPRIN family member 3
Synonyms
MMRRC Submission 039356-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R1290 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location59347226-59426294 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59354464 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 286 (F286S)
Ref Sequence ENSEMBL: ENSMUSP00000051805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051065]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051065
AA Change: F286S

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000051805
Gene: ENSMUSG00000045441
AA Change: F286S

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
low complexity region 311 329 N/A INTRINSIC
low complexity region 593 609 N/A INTRINSIC
Pfam:GRIN_C 627 758 2.7e-49 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfrp1 C T 2: 181,364,604 probably null Het
Borcs5 A G 6: 134,644,368 D34G possibly damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Efl1 T C 7: 82,671,728 V123A probably damaging Het
Exd2 T A 12: 80,484,326 L99Q probably benign Het
Fnip2 T C 3: 79,465,693 D1026G probably damaging Het
Gramd1b A G 9: 40,316,821 probably null Het
Ints1 A T 5: 139,771,410 L417* probably null Het
Iqgap2 A T 13: 95,668,513 V845E probably damaging Het
Kcnh3 G A 15: 99,227,120 probably null Het
Mbd1 T C 18: 74,269,486 S20P possibly damaging Het
Mef2c A T 13: 83,662,359 T375S probably benign Het
Mmp16 A T 4: 18,051,725 N238I probably damaging Het
Neurod2 A T 11: 98,327,288 V350E possibly damaging Het
P3h2 C T 16: 25,987,203 E297K probably damaging Het
Pcdhb1 A G 18: 37,265,230 H78R possibly damaging Het
Slc22a14 A C 9: 119,178,452 L297R probably damaging Het
Slc22a8 G A 19: 8,609,911 G445D probably damaging Het
Spink5 A G 18: 44,007,711 D659G probably damaging Het
St6gal1 A G 16: 23,321,661 Q194R probably benign Het
Tas2r104 A T 6: 131,684,845 C300* probably null Het
Ttc6 G A 12: 57,660,413 S702N probably benign Het
Wnk4 C G 11: 101,276,340 probably benign Het
Zfyve28 A T 5: 34,198,801 D785E probably benign Het
Other mutations in Gprin3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Gprin3 APN 6 59353837 missense possibly damaging 0.72
IGL02059:Gprin3 APN 6 59355325 utr 5 prime probably benign
IGL02080:Gprin3 APN 6 59354191 missense possibly damaging 0.91
IGL02183:Gprin3 APN 6 59353162 missense possibly damaging 0.87
IGL02267:Gprin3 APN 6 59354473 missense probably benign 0.02
IGL02801:Gprin3 APN 6 59354981 missense possibly damaging 0.53
IGL03212:Gprin3 APN 6 59355028 missense probably benign
R0505:Gprin3 UTSW 6 59353387 missense probably damaging 0.98
R0944:Gprin3 UTSW 6 59353915 missense possibly damaging 0.72
R1028:Gprin3 UTSW 6 59354609 missense possibly damaging 0.53
R1180:Gprin3 UTSW 6 59354936 missense possibly damaging 0.86
R2060:Gprin3 UTSW 6 59354519 missense possibly damaging 0.73
R2403:Gprin3 UTSW 6 59354149 missense probably benign 0.13
R3830:Gprin3 UTSW 6 59353633 missense probably benign 0.12
R3893:Gprin3 UTSW 6 59354479 missense probably benign 0.12
R3983:Gprin3 UTSW 6 59354560 missense possibly damaging 0.72
R4812:Gprin3 UTSW 6 59353365 missense possibly damaging 0.85
R4932:Gprin3 UTSW 6 59354173 missense probably benign 0.33
R4944:Gprin3 UTSW 6 59354659 missense probably benign 0.00
R5523:Gprin3 UTSW 6 59353946 nonsense probably null
R5677:Gprin3 UTSW 6 59353892 missense possibly damaging 0.73
R5772:Gprin3 UTSW 6 59354413 missense possibly damaging 0.86
R5879:Gprin3 UTSW 6 59354713 missense probably benign
R5881:Gprin3 UTSW 6 59354786 missense probably benign 0.18
R6044:Gprin3 UTSW 6 59353672 missense possibly damaging 0.72
R6272:Gprin3 UTSW 6 59353331 nonsense probably null
R7140:Gprin3 UTSW 6 59355143 missense possibly damaging 0.85
R7528:Gprin3 UTSW 6 59354032 missense possibly damaging 0.85
R7891:Gprin3 UTSW 6 59353711 missense probably benign 0.22
R7974:Gprin3 UTSW 6 59353711 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- AGTTCCAACAAGTGGTTCCCACTG -3'
(R):5'- GTGAAATCCGAGGCAAACTCAAACG -3'

Sequencing Primer
(F):5'- CATGGCAAATGACACGCAG -3'
(R):5'- GTGTCCAGTGAACCTCCAGTAAG -3'
Posted On2014-01-29