Incidental Mutation 'R1243:Gm996'
ID152054
Institutional Source Beutler Lab
Gene Symbol Gm996
Ensembl Gene ENSMUSG00000029419
Gene Namepredicted gene 996
SynonymsLOC381353
MMRRC Submission 039310-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R1243 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location25575416-25581757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25578558 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 447 (R447Q)
Ref Sequence ENSEMBL: ENSMUSP00000140109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039156] [ENSMUST00000058137] [ENSMUST00000114217] [ENSMUST00000187017] [ENSMUST00000188161] [ENSMUST00000191602]
Predicted Effect probably benign
Transcript: ENSMUST00000039156
SMART Domains Protein: ENSMUSP00000037417
Gene: ENSMUSG00000036504

DomainStartEndE-ValueType
Pfam:Ocnus 5 116 1e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058137
SMART Domains Protein: ENSMUSP00000058746
Gene: ENSMUSG00000015087

DomainStartEndE-ValueType
Pfam:Ras 45 108 1.5e-7 PFAM
Pfam:Roc 45 112 2.2e-8 PFAM
low complexity region 232 245 N/A INTRINSIC
low complexity region 291 325 N/A INTRINSIC
low complexity region 343 364 N/A INTRINSIC
low complexity region 378 397 N/A INTRINSIC
low complexity region 480 492 N/A INTRINSIC
coiled coil region 653 669 N/A INTRINSIC
low complexity region 708 720 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114217
AA Change: R447Q

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109855
Gene: ENSMUSG00000029419
AA Change: R447Q

DomainStartEndE-ValueType
low complexity region 61 92 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 617 636 N/A INTRINSIC
low complexity region 815 843 N/A INTRINSIC
low complexity region 880 894 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142811
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147096
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181730
Predicted Effect probably benign
Transcript: ENSMUST00000187017
Predicted Effect possibly damaging
Transcript: ENSMUST00000188161
AA Change: R447Q

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140763
Gene: ENSMUSG00000029419
AA Change: R447Q

DomainStartEndE-ValueType
low complexity region 61 92 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 617 636 N/A INTRINSIC
low complexity region 815 843 N/A INTRINSIC
low complexity region 880 894 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000191602
AA Change: R447Q

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140109
Gene: ENSMUSG00000029419
AA Change: R447Q

DomainStartEndE-ValueType
low complexity region 61 92 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 617 636 N/A INTRINSIC
low complexity region 815 843 N/A INTRINSIC
low complexity region 880 894 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,750,364 L1114P probably damaging Het
Casp8ap2 A G 4: 32,645,687 S1587G probably benign Het
Cyp24a1 T C 2: 170,495,406 E154G probably benign Het
Disp2 C T 2: 118,791,822 R1012C probably damaging Het
Dync2h1 A G 9: 7,120,882 L2135P probably benign Het
Epb41l2 A G 10: 25,489,043 R578G possibly damaging Het
Mus81 G C 19: 5,485,117 R295G probably benign Het
Myh3 T C 11: 67,090,453 I714T possibly damaging Het
Myof A G 19: 37,936,092 L1251P probably damaging Het
Nos1 A G 5: 117,905,472 Y604C probably damaging Het
Olfr992 T C 2: 85,400,273 S87G probably benign Het
Pappa2 T A 1: 158,845,100 Q1091L probably damaging Het
Pdia4 C T 6: 47,807,120 D117N probably damaging Het
Slc34a1 G A 13: 55,412,131 A304T possibly damaging Het
Vmn2r98 A T 17: 19,065,948 E236V possibly damaging Het
Zfp956 A G 6: 47,956,051 T87A probably damaging Het
Other mutations in Gm996
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Gm996 APN 2 25579407 missense probably damaging 0.97
IGL01370:Gm996 APN 2 25578957 missense possibly damaging 0.82
IGL01973:Gm996 APN 2 25579572 nonsense probably null
IGL01987:Gm996 APN 2 25577958 missense possibly damaging 0.82
IGL02534:Gm996 APN 2 25577031 nonsense probably null
R0457:Gm996 UTSW 2 25578346 missense possibly damaging 0.66
R0799:Gm996 UTSW 2 25578562 missense possibly damaging 0.83
R0931:Gm996 UTSW 2 25578489 missense possibly damaging 0.82
R1477:Gm996 UTSW 2 25579753 missense possibly damaging 0.66
R1559:Gm996 UTSW 2 25577031 nonsense probably null
R1661:Gm996 UTSW 2 25579155 missense possibly damaging 0.90
R1796:Gm996 UTSW 2 25577988 missense probably damaging 1.00
R3955:Gm996 UTSW 2 25577571 nonsense probably null
R4005:Gm996 UTSW 2 25578856 missense probably benign 0.01
R4342:Gm996 UTSW 2 25579108 missense possibly damaging 0.92
R4579:Gm996 UTSW 2 25579649 missense possibly damaging 0.66
R4621:Gm996 UTSW 2 25578400 missense probably damaging 0.96
R4770:Gm996 UTSW 2 25579747 missense possibly damaging 0.94
R4834:Gm996 UTSW 2 25579518 missense possibly damaging 0.82
R4860:Gm996 UTSW 2 25578753 missense probably damaging 0.99
R4860:Gm996 UTSW 2 25578753 missense probably damaging 0.99
R4887:Gm996 UTSW 2 25579747 missense possibly damaging 0.94
R4888:Gm996 UTSW 2 25579747 missense possibly damaging 0.94
R5472:Gm996 UTSW 2 25579702 missense probably benign
R5632:Gm996 UTSW 2 25579264 missense probably benign
R6816:Gm996 UTSW 2 25579721 frame shift probably null
R6818:Gm996 UTSW 2 25579721 frame shift probably null
R6861:Gm996 UTSW 2 25579721 frame shift probably null
R7164:Gm996 UTSW 2 25578567 missense possibly damaging 0.66
R7543:Gm996 UTSW 2 25577398 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CTGTGATGGTAATCTCTGGCGTGAC -3'
(R):5'- CACTTTCTACACCGAGGACTTTGGG -3'

Sequencing Primer
(F):5'- AATCTCTGGCGTGACGTACC -3'
(R):5'- GATGTACTGGCTCGGACTTACC -3'
Posted On2014-01-29