Incidental Mutation 'R7164:Gm996'
ID 557778
Institutional Source Beutler Lab
Gene Symbol Gm996
Ensembl Gene ENSMUSG00000029419
Gene Name predicted gene 996
Synonyms LOC381353
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock # R7164 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 25575416-25581757 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 25578567 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 444 (H444L)
Ref Sequence ENSEMBL: ENSMUSP00000109855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039156] [ENSMUST00000058137] [ENSMUST00000114217] [ENSMUST00000187017] [ENSMUST00000188161] [ENSMUST00000191602]
AlphaFold A2AJA9
Predicted Effect probably benign
Transcript: ENSMUST00000039156
SMART Domains Protein: ENSMUSP00000037417
Gene: ENSMUSG00000036504

DomainStartEndE-ValueType
Pfam:Ocnus 5 116 1e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058137
SMART Domains Protein: ENSMUSP00000058746
Gene: ENSMUSG00000015087

DomainStartEndE-ValueType
Pfam:Ras 45 108 1.5e-7 PFAM
Pfam:Roc 45 112 2.2e-8 PFAM
low complexity region 232 245 N/A INTRINSIC
low complexity region 291 325 N/A INTRINSIC
low complexity region 343 364 N/A INTRINSIC
low complexity region 378 397 N/A INTRINSIC
low complexity region 480 492 N/A INTRINSIC
coiled coil region 653 669 N/A INTRINSIC
low complexity region 708 720 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114217
AA Change: H444L

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109855
Gene: ENSMUSG00000029419
AA Change: H444L

DomainStartEndE-ValueType
low complexity region 61 92 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 617 636 N/A INTRINSIC
low complexity region 815 843 N/A INTRINSIC
low complexity region 880 894 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187017
Predicted Effect possibly damaging
Transcript: ENSMUST00000188161
AA Change: H444L

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140763
Gene: ENSMUSG00000029419
AA Change: H444L

DomainStartEndE-ValueType
low complexity region 61 92 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 617 636 N/A INTRINSIC
low complexity region 815 843 N/A INTRINSIC
low complexity region 880 894 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000191602
AA Change: H444L

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140109
Gene: ENSMUSG00000029419
AA Change: H444L

DomainStartEndE-ValueType
low complexity region 61 92 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 617 636 N/A INTRINSIC
low complexity region 815 843 N/A INTRINSIC
low complexity region 880 894 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik C A 4: 107,894,890 D155E not run Het
4932415D10Rik G A 10: 82,286,229 T3649I probably damaging Het
Actn2 G A 13: 12,278,961 H558Y probably damaging Het
Akap9 G C 5: 4,060,364 E3022D probably damaging Het
Anapc2 C T 2: 25,284,999 R710C probably damaging Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Carmil3 A G 14: 55,501,282 E844G probably damaging Het
Cdk17 T G 10: 93,232,481 S367A probably benign Het
Cfap206 T A 4: 34,719,656 M253L probably benign Het
Chd3 T G 11: 69,362,306 K228Q probably damaging Het
Cit T A 5: 115,985,787 I1503N possibly damaging Het
Csn1s1 A G 5: 87,674,228 N119S possibly damaging Het
Degs1 A G 1: 182,279,125 S226P probably damaging Het
Espl1 T C 15: 102,313,203 W976R probably damaging Het
Fbxl4 C T 4: 22,386,218 P275L probably benign Het
Flnb A G 14: 7,915,944 probably null Het
Gnptab T A 10: 88,434,070 Y878* probably null Het
Gpr89 A T 3: 96,871,398 M453K probably benign Het
Igsf5 A T 16: 96,372,848 Q26L possibly damaging Het
Inpp5e T A 2: 26,407,983 D202V possibly damaging Het
Itga3 C T 11: 95,052,479 V931M possibly damaging Het
Kcnab3 T C 11: 69,331,358 probably null Het
Klk4 T C 7: 43,881,698 I17T possibly damaging Het
Lrrc73 T C 17: 46,256,243 L206P probably damaging Het
Manba A T 3: 135,542,388 N346I probably damaging Het
Map4k4 T C 1: 39,973,972 Y76H possibly damaging Het
Map4k5 T C 12: 69,830,436 T312A probably benign Het
Masp2 A G 4: 148,610,115 probably null Het
Mast1 T C 8: 84,935,304 D63G possibly damaging Het
Mtf2 T A 5: 108,093,369 S254T possibly damaging Het
Myo16 A T 8: 10,569,585 T1379S unknown Het
Myo5a A G 9: 75,180,153 E1097G probably benign Het
Nat1 T C 8: 67,491,677 V238A possibly damaging Het
Nhlrc2 A G 19: 56,592,499 D493G probably damaging Het
Olfr1165-ps T C 2: 88,101,832 K52E probably damaging Het
Olfr1331 C T 4: 118,869,725 P315S probably benign Het
Olfr1462 A T 19: 13,190,906 M80L probably benign Het
Olfr291 A G 7: 84,857,043 I227V possibly damaging Het
Olfr50 T C 2: 36,793,697 S154P probably benign Het
Olfr919 A G 9: 38,698,219 I49T possibly damaging Het
Pcsk5 C T 19: 17,451,985 C1543Y probably damaging Het
Pde4d A G 13: 109,032,688 D88G probably benign Het
Pld5 A T 1: 176,213,621 M1K probably null Het
Prmt6 A G 3: 110,250,364 M203T probably benign Het
Prr14l A T 5: 32,829,166 V995D probably damaging Het
Psg18 T C 7: 18,350,937 E199G possibly damaging Het
Pth1r A G 9: 110,723,747 I439T possibly damaging Het
Ptprc T A 1: 138,117,862 I87F probably benign Het
Slc44a1 T C 4: 53,528,711 S154P probably benign Het
Slco1c1 T A 6: 141,542,129 Y192* probably null Het
Spag16 A G 1: 70,724,866 H615R possibly damaging Het
Tas2r114 G A 6: 131,689,765 A100V possibly damaging Het
U2af1l4 T C 7: 30,565,119 S103P probably benign Het
Usp10 T C 8: 119,942,108 S383P probably damaging Het
Vmn2r113 A G 17: 22,948,163 R505G probably benign Het
Vmn2r75 A C 7: 86,165,384 D300E probably damaging Het
Zfp318 T A 17: 46,397,306 probably null Het
Zfp318 T C 17: 46,405,939 V999A probably damaging Het
Zfp324 A T 7: 12,968,883 H58L probably damaging Het
Zfp707 A G 15: 75,975,118 E339G possibly damaging Het
Other mutations in Gm996
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Gm996 APN 2 25579407 missense probably damaging 0.97
IGL01370:Gm996 APN 2 25578957 missense possibly damaging 0.82
IGL01973:Gm996 APN 2 25579572 nonsense probably null
IGL01987:Gm996 APN 2 25577958 missense possibly damaging 0.82
IGL02534:Gm996 APN 2 25577031 nonsense probably null
R0457:Gm996 UTSW 2 25578346 missense possibly damaging 0.66
R0799:Gm996 UTSW 2 25578562 missense possibly damaging 0.83
R0931:Gm996 UTSW 2 25578489 missense possibly damaging 0.82
R1243:Gm996 UTSW 2 25578558 missense possibly damaging 0.66
R1477:Gm996 UTSW 2 25579753 missense possibly damaging 0.66
R1559:Gm996 UTSW 2 25577031 nonsense probably null
R1661:Gm996 UTSW 2 25579155 missense possibly damaging 0.90
R1796:Gm996 UTSW 2 25577988 missense probably damaging 1.00
R3955:Gm996 UTSW 2 25577571 nonsense probably null
R4005:Gm996 UTSW 2 25578856 missense probably benign 0.01
R4342:Gm996 UTSW 2 25579108 missense possibly damaging 0.92
R4579:Gm996 UTSW 2 25579649 missense possibly damaging 0.66
R4621:Gm996 UTSW 2 25578400 missense probably damaging 0.96
R4770:Gm996 UTSW 2 25579747 missense possibly damaging 0.94
R4834:Gm996 UTSW 2 25579518 missense possibly damaging 0.82
R4860:Gm996 UTSW 2 25578753 missense probably damaging 0.99
R4860:Gm996 UTSW 2 25578753 missense probably damaging 0.99
R4887:Gm996 UTSW 2 25579747 missense possibly damaging 0.94
R4888:Gm996 UTSW 2 25579747 missense possibly damaging 0.94
R5472:Gm996 UTSW 2 25579702 missense probably benign
R5632:Gm996 UTSW 2 25579264 missense probably benign
R6816:Gm996 UTSW 2 25579721 frame shift probably null
R6818:Gm996 UTSW 2 25579721 frame shift probably null
R6861:Gm996 UTSW 2 25579721 frame shift probably null
R7543:Gm996 UTSW 2 25577398 missense possibly damaging 0.81
R7748:Gm996 UTSW 2 25578959 missense possibly damaging 0.46
R7783:Gm996 UTSW 2 25577808 missense probably damaging 0.97
R7826:Gm996 UTSW 2 25578465 missense possibly damaging 0.66
R8117:Gm996 UTSW 2 25579234 missense probably benign 0.27
R8694:Gm996 UTSW 2 25579819 missense possibly damaging 0.83
R8708:Gm996 UTSW 2 25577802 missense possibly damaging 0.66
R8830:Gm996 UTSW 2 25577250 missense
R8904:Gm996 UTSW 2 25577902 missense probably benign 0.27
R8928:Gm996 UTSW 2 25578565 missense possibly damaging 0.92
R9253:Gm996 UTSW 2 25577160 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TAATCTCTGGCGTGACGTACC -3'
(R):5'- ATGTACTGGCTCGGACTTACC -3'

Sequencing Primer
(F):5'- CTGGCGTGACGTACCAGTTG -3'
(R):5'- GGACTTACCCGCACCCG -3'
Posted On 2019-06-26