Incidental Mutation 'R7164:Gm996'
ID557778
Institutional Source Beutler Lab
Gene Symbol Gm996
Ensembl Gene ENSMUSG00000029419
Gene Namepredicted gene 996
SynonymsLOC381353
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R7164 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location25575416-25581757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25578567 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 444 (H444L)
Ref Sequence ENSEMBL: ENSMUSP00000109855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039156] [ENSMUST00000058137] [ENSMUST00000114217] [ENSMUST00000187017] [ENSMUST00000188161] [ENSMUST00000191602]
Predicted Effect probably benign
Transcript: ENSMUST00000039156
SMART Domains Protein: ENSMUSP00000037417
Gene: ENSMUSG00000036504

DomainStartEndE-ValueType
Pfam:Ocnus 5 116 1e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058137
SMART Domains Protein: ENSMUSP00000058746
Gene: ENSMUSG00000015087

DomainStartEndE-ValueType
Pfam:Ras 45 108 1.5e-7 PFAM
Pfam:Roc 45 112 2.2e-8 PFAM
low complexity region 232 245 N/A INTRINSIC
low complexity region 291 325 N/A INTRINSIC
low complexity region 343 364 N/A INTRINSIC
low complexity region 378 397 N/A INTRINSIC
low complexity region 480 492 N/A INTRINSIC
coiled coil region 653 669 N/A INTRINSIC
low complexity region 708 720 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114217
AA Change: H444L

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109855
Gene: ENSMUSG00000029419
AA Change: H444L

DomainStartEndE-ValueType
low complexity region 61 92 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 617 636 N/A INTRINSIC
low complexity region 815 843 N/A INTRINSIC
low complexity region 880 894 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187017
Predicted Effect possibly damaging
Transcript: ENSMUST00000188161
AA Change: H444L

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140763
Gene: ENSMUSG00000029419
AA Change: H444L

DomainStartEndE-ValueType
low complexity region 61 92 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 617 636 N/A INTRINSIC
low complexity region 815 843 N/A INTRINSIC
low complexity region 880 894 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000191602
AA Change: H444L

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140109
Gene: ENSMUSG00000029419
AA Change: H444L

DomainStartEndE-ValueType
low complexity region 61 92 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 617 636 N/A INTRINSIC
low complexity region 815 843 N/A INTRINSIC
low complexity region 880 894 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik C A 4: 107,894,890 D155E not run Het
4932415D10Rik G A 10: 82,286,229 T3649I probably damaging Het
Actn2 G A 13: 12,278,961 H558Y probably damaging Het
Akap9 G C 5: 4,060,364 E3022D probably damaging Het
Anapc2 C T 2: 25,284,999 R710C probably damaging Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Carmil3 A G 14: 55,501,282 E844G probably damaging Het
Cdk17 T G 10: 93,232,481 S367A probably benign Het
Cfap206 T A 4: 34,719,656 M253L probably benign Het
Chd3 T G 11: 69,362,306 K228Q probably damaging Het
Cit T A 5: 115,985,787 I1503N possibly damaging Het
Csn1s1 A G 5: 87,674,228 N119S possibly damaging Het
Degs1 A G 1: 182,279,125 S226P probably damaging Het
Espl1 T C 15: 102,313,203 W976R probably damaging Het
Fbxl4 C T 4: 22,386,218 P275L probably benign Het
Flnb A G 14: 7,915,944 probably null Het
Gnptab T A 10: 88,434,070 Y878* probably null Het
Gpr89 A T 3: 96,871,398 M453K probably benign Het
Igsf5 A T 16: 96,372,848 Q26L possibly damaging Het
Inpp5e T A 2: 26,407,983 D202V possibly damaging Het
Itga3 C T 11: 95,052,479 V931M possibly damaging Het
Kcnab3 T C 11: 69,331,358 probably null Het
Klk4 T C 7: 43,881,698 I17T possibly damaging Het
Lrrc73 T C 17: 46,256,243 L206P probably damaging Het
Manba A T 3: 135,542,388 N346I probably damaging Het
Map4k4 T C 1: 39,973,972 Y76H possibly damaging Het
Map4k5 T C 12: 69,830,436 T312A probably benign Het
Masp2 A G 4: 148,610,115 probably null Het
Mast1 T C 8: 84,935,304 D63G possibly damaging Het
Mtf2 T A 5: 108,093,369 S254T possibly damaging Het
Myo16 A T 8: 10,569,585 T1379S unknown Het
Myo5a A G 9: 75,180,153 E1097G probably benign Het
Nat1 T C 8: 67,491,677 V238A possibly damaging Het
Nhlrc2 A G 19: 56,592,499 D493G probably damaging Het
Olfr1165-ps T C 2: 88,101,832 K52E probably damaging Het
Olfr1331 C T 4: 118,869,725 P315S probably benign Het
Olfr1462 A T 19: 13,190,906 M80L probably benign Het
Olfr291 A G 7: 84,857,043 I227V possibly damaging Het
Olfr50 T C 2: 36,793,697 S154P probably benign Het
Olfr919 A G 9: 38,698,219 I49T possibly damaging Het
Pcsk5 C T 19: 17,451,985 C1543Y probably damaging Het
Pde4d A G 13: 109,032,688 D88G probably benign Het
Pld5 A T 1: 176,213,621 M1K probably null Het
Prmt6 A G 3: 110,250,364 M203T probably benign Het
Prr14l A T 5: 32,829,166 V995D probably damaging Het
Psg18 T C 7: 18,350,937 E199G possibly damaging Het
Pth1r A G 9: 110,723,747 I439T possibly damaging Het
Ptprc T A 1: 138,117,862 I87F probably benign Het
Slc44a1 T C 4: 53,528,711 S154P probably benign Het
Slco1c1 T A 6: 141,542,129 Y192* probably null Het
Spag16 A G 1: 70,724,866 H615R possibly damaging Het
Tas2r114 G A 6: 131,689,765 A100V possibly damaging Het
U2af1l4 T C 7: 30,565,119 S103P probably benign Het
Usp10 T C 8: 119,942,108 S383P probably damaging Het
Vmn2r113 A G 17: 22,948,163 R505G probably benign Het
Vmn2r75 A C 7: 86,165,384 D300E probably damaging Het
Zfp318 T A 17: 46,397,306 probably null Het
Zfp318 T C 17: 46,405,939 V999A probably damaging Het
Zfp324 A T 7: 12,968,883 H58L probably damaging Het
Zfp707 A G 15: 75,975,118 E339G possibly damaging Het
Other mutations in Gm996
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Gm996 APN 2 25579407 missense probably damaging 0.97
IGL01370:Gm996 APN 2 25578957 missense possibly damaging 0.82
IGL01973:Gm996 APN 2 25579572 nonsense probably null
IGL01987:Gm996 APN 2 25577958 missense possibly damaging 0.82
IGL02534:Gm996 APN 2 25577031 nonsense probably null
R0457:Gm996 UTSW 2 25578346 missense possibly damaging 0.66
R0799:Gm996 UTSW 2 25578562 missense possibly damaging 0.83
R0931:Gm996 UTSW 2 25578489 missense possibly damaging 0.82
R1243:Gm996 UTSW 2 25578558 missense possibly damaging 0.66
R1477:Gm996 UTSW 2 25579753 missense possibly damaging 0.66
R1559:Gm996 UTSW 2 25577031 nonsense probably null
R1661:Gm996 UTSW 2 25579155 missense possibly damaging 0.90
R1796:Gm996 UTSW 2 25577988 missense probably damaging 1.00
R3955:Gm996 UTSW 2 25577571 nonsense probably null
R4005:Gm996 UTSW 2 25578856 missense probably benign 0.01
R4342:Gm996 UTSW 2 25579108 missense possibly damaging 0.92
R4579:Gm996 UTSW 2 25579649 missense possibly damaging 0.66
R4621:Gm996 UTSW 2 25578400 missense probably damaging 0.96
R4770:Gm996 UTSW 2 25579747 missense possibly damaging 0.94
R4834:Gm996 UTSW 2 25579518 missense possibly damaging 0.82
R4860:Gm996 UTSW 2 25578753 missense probably damaging 0.99
R4860:Gm996 UTSW 2 25578753 missense probably damaging 0.99
R4887:Gm996 UTSW 2 25579747 missense possibly damaging 0.94
R4888:Gm996 UTSW 2 25579747 missense possibly damaging 0.94
R5472:Gm996 UTSW 2 25579702 missense probably benign
R5632:Gm996 UTSW 2 25579264 missense probably benign
R6816:Gm996 UTSW 2 25579721 frame shift probably null
R6818:Gm996 UTSW 2 25579721 frame shift probably null
R6861:Gm996 UTSW 2 25579721 frame shift probably null
R7543:Gm996 UTSW 2 25577398 missense possibly damaging 0.81
R7748:Gm996 UTSW 2 25578959 missense possibly damaging 0.46
R7783:Gm996 UTSW 2 25577808 missense probably damaging 0.97
R7826:Gm996 UTSW 2 25578465 missense possibly damaging 0.66
R8117:Gm996 UTSW 2 25579234 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TAATCTCTGGCGTGACGTACC -3'
(R):5'- ATGTACTGGCTCGGACTTACC -3'

Sequencing Primer
(F):5'- CTGGCGTGACGTACCAGTTG -3'
(R):5'- GGACTTACCCGCACCCG -3'
Posted On2019-06-26