Incidental Mutation 'R1243:Olfr992'
ID152055
Institutional Source Beutler Lab
Gene Symbol Olfr992
Ensembl Gene ENSMUSG00000075221
Gene Nameolfactory receptor 992
SynonymsMOR203-1, GA_x6K02T2Q125-46877170-46876241
MMRRC Submission 039310-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R1243 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location85398824-85409469 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85400273 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 87 (S87G)
Ref Sequence ENSEMBL: ENSMUSP00000149333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099927] [ENSMUST00000213749] [ENSMUST00000214895] [ENSMUST00000215617]
Predicted Effect probably benign
Transcript: ENSMUST00000099927
AA Change: S87G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097511
Gene: ENSMUSG00000075221
AA Change: S87G

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3.3e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 285 3.3e-6 PFAM
Pfam:7tm_1 41 290 7.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213749
AA Change: S87G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000214895
AA Change: S87G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215617
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215967
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,750,364 L1114P probably damaging Het
Casp8ap2 A G 4: 32,645,687 S1587G probably benign Het
Cyp24a1 T C 2: 170,495,406 E154G probably benign Het
Disp2 C T 2: 118,791,822 R1012C probably damaging Het
Dync2h1 A G 9: 7,120,882 L2135P probably benign Het
Epb41l2 A G 10: 25,489,043 R578G possibly damaging Het
Gm996 C T 2: 25,578,558 R447Q possibly damaging Het
Mus81 G C 19: 5,485,117 R295G probably benign Het
Myh3 T C 11: 67,090,453 I714T possibly damaging Het
Myof A G 19: 37,936,092 L1251P probably damaging Het
Nos1 A G 5: 117,905,472 Y604C probably damaging Het
Pappa2 T A 1: 158,845,100 Q1091L probably damaging Het
Pdia4 C T 6: 47,807,120 D117N probably damaging Het
Slc34a1 G A 13: 55,412,131 A304T possibly damaging Het
Vmn2r98 A T 17: 19,065,948 E236V possibly damaging Het
Zfp956 A G 6: 47,956,051 T87A probably damaging Het
Other mutations in Olfr992
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01613:Olfr992 APN 2 85400171 missense probably damaging 1.00
IGL02538:Olfr992 APN 2 85400303 missense probably damaging 1.00
IGL02550:Olfr992 APN 2 85399822 missense probably damaging 0.99
R0128:Olfr992 UTSW 2 85399961 missense probably damaging 0.99
R0130:Olfr992 UTSW 2 85399961 missense probably damaging 0.99
R0345:Olfr992 UTSW 2 85400341 missense possibly damaging 0.60
R0413:Olfr992 UTSW 2 85399675 missense probably damaging 1.00
R0535:Olfr992 UTSW 2 85400095 missense possibly damaging 0.71
R1255:Olfr992 UTSW 2 85400303 missense probably damaging 1.00
R1293:Olfr992 UTSW 2 85400353 splice site probably null
R1840:Olfr992 UTSW 2 85400168 missense probably benign 0.42
R1847:Olfr992 UTSW 2 85400441 missense probably damaging 0.99
R2300:Olfr992 UTSW 2 85400132 missense probably benign
R4574:Olfr992 UTSW 2 85400026 missense probably damaging 1.00
R4872:Olfr992 UTSW 2 85400428 missense probably damaging 1.00
R5435:Olfr992 UTSW 2 85400470 missense probably benign 0.05
R6846:Olfr992 UTSW 2 85400517 missense probably damaging 1.00
R7075:Olfr992 UTSW 2 85400200 missense probably damaging 1.00
R7253:Olfr992 UTSW 2 85399639 missense probably benign 0.00
R7454:Olfr992 UTSW 2 85399611 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCCATAGTGTATGAACCAAGCAGCAG -3'
(R):5'- TGGTCAAAATGAGTCTTGGCACATCC -3'

Sequencing Primer
(F):5'- CAGCAAAATGCAGAGTCTCTGG -3'
(R):5'- TGGCACATCCTCTTTGTGG -3'
Posted On2014-01-29