Mutagenetix > Incidental Mutation

Incidental Mutation 'R1427:Sec23ip'

161359

Institutional Source

Beutler Lab

Gene Symbol

Sec23ip

Ensembl Gene

ENSMUSG00000055319

Gene Name

Sec23 interacting protein

Synonyms

p125, D7Ertd373e

MMRRC Submission

039483-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.583) question?

Stock #

R1427 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

128346667-128386560 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 128378609 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 808 (R808C)

Ref Sequence

ENSEMBL: ENSMUSP00000035610 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042942]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000042942
AA Change: R808C

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000035610
Gene: ENSMUSG00000055319
AA Change: R808C

Domain	Start	End	E-Value	Type
low complexity region	8	26	N/A	INTRINSIC
low complexity region	41	51	N/A	INTRINSIC
low complexity region	79	88	N/A	INTRINSIC
low complexity region	203	215	N/A	INTRINSIC
low complexity region	222	230	N/A	INTRINSIC
Blast:DDHD	513	585	8e-33	BLAST
SAM	637	702	2.18e-9	SMART
DDHD	777	987	1.33e-74	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000104095

Coding Region Coverage

1x: 98.9%
3x: 97.8%
10x: 94.7%
20x: 87.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phosphatidic acid preferring-phospholipase A1 family. The encoded protein is localized to endoplasmic reticulum exit sites and plays a critical role in ER-Golgi transport as part of the multimeric coat protein II complex. An orthologous gene in frogs is required for normal neural crest cell development, suggesting that this gene may play a role in Waardenburg syndrome neural crest defects. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Male mice homozygous for a null allele display reduced fertility with globozoospermia and impaired fertilization. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 23 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl4	A	G	4: 144,349,610 (GRCm39)	N289S	probably damaging	Het
Abhd12b	A	G	12: 70,229,193 (GRCm39)	D223G	probably damaging	Het
Agap3	A	G	5: 24,681,691 (GRCm39)	T333A	probably benign	Het
Arhgap28	C	A	17: 68,164,459 (GRCm39)	Q554H	probably damaging	Het
Clcnkb	A	G	4: 141,132,620 (GRCm39)	L603P	probably damaging	Het
Dchs1	T	C	7: 105,415,398 (GRCm39)	D626G	probably benign	Het
Eml3	T	C	19: 8,911,225 (GRCm39)	Y285H	probably damaging	Het
Ganab	A	G	19: 8,893,030 (GRCm39)	T945A	probably benign	Het
Iars1	A	T	13: 49,857,745 (GRCm39)		probably null	Het
Kalrn	A	G	16: 33,796,124 (GRCm39)	F1217S	probably damaging	Het
Lipf	T	C	19: 33,943,000 (GRCm39)	F103L	probably damaging	Het
Lpar2	C	A	8: 70,276,700 (GRCm39)	A163E	possibly damaging	Het
Myh1	T	C	11: 67,110,573 (GRCm39)	Y1495H	probably damaging	Het
Or5p63	A	G	7: 107,811,301 (GRCm39)	I145T	probably benign	Het
Ppp3ca	T	A	3: 136,627,675 (GRCm39)	L413H	probably damaging	Het
Ptpn7	T	C	1: 135,062,192 (GRCm39)	V46A	possibly damaging	Het
Rps24	A	G	14: 24,541,830 (GRCm39)	T6A	probably damaging	Het
Slc25a26	T	C	6: 94,487,828 (GRCm39)	S96P	probably damaging	Het
Stard13	G	A	5: 150,969,456 (GRCm39)	R898W	probably damaging	Het
Tenm4	T	C	7: 96,492,255 (GRCm39)	V1063A	probably benign	Het
Tm6sf2	T	G	8: 70,528,232 (GRCm39)	M127R	probably damaging	Het
Ttn	A	T	2: 76,583,448 (GRCm39)	W22482R	probably damaging	Het
Zfp384	T	C	6: 125,001,847 (GRCm39)	L109P	probably damaging	Het

Other mutations in Sec23ip

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00825:Sec23ip	APN	7	128,369,333 (GRCm39)	missense	probably damaging	1.00
IGL01347:Sec23ip	APN	7	128,364,129 (GRCm39)	missense	probably benign	0.08
IGL01358:Sec23ip	APN	7	128,354,521 (GRCm39)	missense	possibly damaging	0.68
IGL01656:Sec23ip	APN	7	128,351,969 (GRCm39)	missense	probably damaging	1.00
IGL01835:Sec23ip	APN	7	128,357,035 (GRCm39)	splice site	probably null
IGL02233:Sec23ip	APN	7	128,380,903 (GRCm39)	missense	probably damaging	1.00
IGL02499:Sec23ip	APN	7	128,378,640 (GRCm39)	missense	probably damaging	1.00
IGL03381:Sec23ip	APN	7	128,352,029 (GRCm39)	missense	probably damaging	0.97
R0053:Sec23ip	UTSW	7	128,346,891 (GRCm39)	missense	probably damaging	1.00
R0147:Sec23ip	UTSW	7	128,380,775 (GRCm39)	splice site	probably benign
R0360:Sec23ip	UTSW	7	128,363,129 (GRCm39)	splice site	probably benign
R1442:Sec23ip	UTSW	7	128,378,510 (GRCm39)	missense	probably benign	0.10
R1462:Sec23ip	UTSW	7	128,367,862 (GRCm39)	missense	probably benign
R1462:Sec23ip	UTSW	7	128,367,862 (GRCm39)	missense	probably benign
R1564:Sec23ip	UTSW	7	128,368,005 (GRCm39)	splice site	probably null
R1876:Sec23ip	UTSW	7	128,354,575 (GRCm39)	missense	probably benign
R1966:Sec23ip	UTSW	7	128,357,077 (GRCm39)	missense	probably damaging	0.98
R1977:Sec23ip	UTSW	7	128,367,997 (GRCm39)	missense	probably damaging	1.00
R2115:Sec23ip	UTSW	7	128,364,185 (GRCm39)	missense	probably benign	0.00
R2847:Sec23ip	UTSW	7	128,355,797 (GRCm39)	missense	probably benign	0.00
R3958:Sec23ip	UTSW	7	128,378,574 (GRCm39)	missense	probably benign	0.35
R3959:Sec23ip	UTSW	7	128,378,574 (GRCm39)	missense	probably benign	0.35
R3960:Sec23ip	UTSW	7	128,378,574 (GRCm39)	missense	probably benign	0.35
R4287:Sec23ip	UTSW	7	128,379,057 (GRCm39)	missense	probably benign	0.37
R4510:Sec23ip	UTSW	7	128,380,900 (GRCm39)	missense	probably damaging	1.00
R4511:Sec23ip	UTSW	7	128,380,900 (GRCm39)	missense	probably damaging	1.00
R4612:Sec23ip	UTSW	7	128,352,226 (GRCm39)	nonsense	probably null
R4660:Sec23ip	UTSW	7	128,352,010 (GRCm39)	missense	probably null	0.00
R4890:Sec23ip	UTSW	7	128,354,634 (GRCm39)	missense	probably damaging	0.98
R5287:Sec23ip	UTSW	7	128,367,860 (GRCm39)	missense	probably benign
R5587:Sec23ip	UTSW	7	128,352,151 (GRCm39)	missense	probably benign
R5625:Sec23ip	UTSW	7	128,346,707 (GRCm39)	unclassified	probably benign
R5656:Sec23ip	UTSW	7	128,378,508 (GRCm39)	missense	probably damaging	1.00
R5808:Sec23ip	UTSW	7	128,373,908 (GRCm39)	missense	probably benign	0.00
R6034:Sec23ip	UTSW	7	128,351,927 (GRCm39)	missense	possibly damaging	0.66
R6034:Sec23ip	UTSW	7	128,351,927 (GRCm39)	missense	possibly damaging	0.66
R6145:Sec23ip	UTSW	7	128,380,208 (GRCm39)	missense	probably damaging	0.99
R6747:Sec23ip	UTSW	7	128,354,573 (GRCm39)	synonymous	silent
R6953:Sec23ip	UTSW	7	128,354,520 (GRCm39)	nonsense	probably null
R6992:Sec23ip	UTSW	7	128,367,164 (GRCm39)	missense	probably benign
R7131:Sec23ip	UTSW	7	128,381,364 (GRCm39)	missense	probably damaging	1.00
R7163:Sec23ip	UTSW	7	128,364,257 (GRCm39)	critical splice donor site	probably null
R7387:Sec23ip	UTSW	7	128,346,727 (GRCm39)	unclassified	probably benign
R7559:Sec23ip	UTSW	7	128,379,074 (GRCm39)	missense	possibly damaging	0.65
R7975:Sec23ip	UTSW	7	128,364,201 (GRCm39)	missense	probably damaging	1.00
R8158:Sec23ip	UTSW	7	128,369,364 (GRCm39)	missense	probably damaging	0.99
R8337:Sec23ip	UTSW	7	128,365,749 (GRCm39)	missense	probably damaging	1.00
R8409:Sec23ip	UTSW	7	128,365,855 (GRCm39)	missense	probably damaging	1.00
R8418:Sec23ip	UTSW	7	128,380,187 (GRCm39)	missense	probably damaging	0.98
R8434:Sec23ip	UTSW	7	128,352,151 (GRCm39)	missense	probably benign
R8461:Sec23ip	UTSW	7	128,373,926 (GRCm39)	missense	probably benign
R8553:Sec23ip	UTSW	7	128,355,777 (GRCm39)	missense	probably damaging	1.00
R8897:Sec23ip	UTSW	7	128,354,467 (GRCm39)	missense	probably benign	0.14
R9059:Sec23ip	UTSW	7	128,365,805 (GRCm39)	missense	probably damaging	1.00
R9142:Sec23ip	UTSW	7	128,363,226 (GRCm39)	missense	probably damaging	1.00
R9674:Sec23ip	UTSW	7	128,380,187 (GRCm39)	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TTCTTCAGCTCACAGCAGCCAC -3'
(R):5'- GCCAGAGAGTGACATTTCCACACC -3'

Sequencing Primer
(F):5'- CATGCTTGGGAGCCAGTG -3'
(R):5'- GCAGAGCAACTAACCTGTTTCTC -3'

Posted On

2014-03-14