Incidental Mutation 'R6953:Sec23ip'
ID 541312
Institutional Source Beutler Lab
Gene Symbol Sec23ip
Ensembl Gene ENSMUSG00000055319
Gene Name Sec23 interacting protein
Synonyms p125, D7Ertd373e
MMRRC Submission 045065-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.583) question?
Stock # R6953 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 128346667-128386560 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 128354520 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Stop codon at position 78 (S78*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042942] [ENSMUST00000206986]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000042942
AA Change: Q259K

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000035610
Gene: ENSMUSG00000055319
AA Change: Q259K

DomainStartEndE-ValueType
low complexity region 8 26 N/A INTRINSIC
low complexity region 41 51 N/A INTRINSIC
low complexity region 79 88 N/A INTRINSIC
low complexity region 203 215 N/A INTRINSIC
low complexity region 222 230 N/A INTRINSIC
Blast:DDHD 513 585 8e-33 BLAST
SAM 637 702 2.18e-9 SMART
DDHD 777 987 1.33e-74 SMART
Predicted Effect probably null
Transcript: ENSMUST00000205856
AA Change: S78*
Predicted Effect probably benign
Transcript: ENSMUST00000206986
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phosphatidic acid preferring-phospholipase A1 family. The encoded protein is localized to endoplasmic reticulum exit sites and plays a critical role in ER-Golgi transport as part of the multimeric coat protein II complex. An orthologous gene in frogs is required for normal neural crest cell development, suggesting that this gene may play a role in Waardenburg syndrome neural crest defects. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Male mice homozygous for a null allele display reduced fertility with globozoospermia and impaired fertilization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik C A 15: 57,892,223 (GRCm39) S128I probably damaging Het
Aadacl2 A C 3: 59,932,181 (GRCm39) H232P possibly damaging Het
Abcc3 A G 11: 94,265,661 (GRCm39) Y125H probably benign Het
Adgrb3 A G 1: 25,865,592 (GRCm39) S84P probably damaging Het
Adgrd1 A T 5: 129,192,142 (GRCm39) K71* probably null Het
Ap2m1 T A 16: 20,361,468 (GRCm39) W381R probably damaging Het
Ascc3 A G 10: 50,521,762 (GRCm39) I426V probably benign Het
BC024063 T A 10: 81,943,733 (GRCm39) D31E possibly damaging Het
C3ar1 G A 6: 122,827,591 (GRCm39) H209Y possibly damaging Het
Ccp110 T C 7: 118,321,644 (GRCm39) V433A possibly damaging Het
Cfap54 A G 10: 92,830,540 (GRCm39) S1199P probably benign Het
Cyp24a1 T G 2: 170,329,866 (GRCm39) D362A probably benign Het
Dapk2 C G 9: 66,161,904 (GRCm39) R271G probably benign Het
Dnmt1 G T 9: 20,829,822 (GRCm39) Q633K probably benign Het
Ercc4 T A 16: 12,948,550 (GRCm39) V499D probably damaging Het
Ier3ip1 C G 18: 77,027,309 (GRCm39) P46R probably damaging Het
Ifi211 T C 1: 173,733,832 (GRCm39) T110A probably damaging Het
Isoc1 A G 18: 58,804,374 (GRCm39) D134G possibly damaging Het
Kif26b A G 1: 178,701,637 (GRCm39) D672G possibly damaging Het
Klhl33 T A 14: 51,128,973 (GRCm39) D752V possibly damaging Het
Lcn4 A G 2: 26,559,367 (GRCm39) Y133H probably benign Het
Mrs2 C A 13: 25,185,771 (GRCm39) V134L probably benign Het
Muc16 T C 9: 18,551,825 (GRCm39) T4823A probably benign Het
Ogfod3 A G 11: 121,093,824 (GRCm39) I62T probably benign Het
Or2m13 C T 16: 19,226,278 (GRCm39) V164I probably benign Het
Or2y10 A G 11: 49,455,117 (GRCm39) Y123C probably damaging Het
Or6c204 A T 10: 129,022,474 (GRCm39) M272K probably benign Het
Or7e175 A T 9: 20,049,299 (GRCm39) I296L probably benign Het
Papln G A 12: 83,828,659 (GRCm39) W788* probably null Het
Pcdhac2 A G 18: 37,277,479 (GRCm39) Q153R probably benign Het
Pcdhgb2 C T 18: 37,823,807 (GRCm39) T266I possibly damaging Het
Pcdhgc5 C A 18: 37,953,514 (GRCm39) R263S possibly damaging Het
Phactr4 T C 4: 132,104,662 (GRCm39) T185A possibly damaging Het
Plcxd2 T C 16: 45,800,882 (GRCm39) D114G probably damaging Het
Polr2a A T 11: 69,632,537 (GRCm39) I987N probably damaging Het
Prl3d3 A G 13: 27,345,029 (GRCm39) M134V probably benign Het
Pum2 T A 12: 8,778,779 (GRCm39) probably null Het
Racgap1 T C 15: 99,524,210 (GRCm39) E399G probably damaging Het
Sbspon A T 1: 15,930,519 (GRCm39) S156T probably damaging Het
Scn1a T C 2: 66,149,813 (GRCm39) T927A probably damaging Het
Serpina1d G A 12: 103,733,989 (GRCm39) T105I probably benign Het
Slc25a21 T A 12: 57,205,954 (GRCm39) N26Y probably benign Het
Smim20 T A 5: 53,435,258 (GRCm39) D64E probably damaging Het
Spag17 T G 3: 99,942,291 (GRCm39) I772S possibly damaging Het
Tars2 T C 3: 95,660,426 (GRCm39) T99A possibly damaging Het
Tdrd1 C T 19: 56,819,803 (GRCm39) T101I probably damaging Het
Tldc2 T G 2: 156,931,198 (GRCm39) probably null Het
Ttn A G 2: 76,601,929 (GRCm39) Y10251H probably damaging Het
Ush2a A G 1: 187,995,342 (GRCm39) R38G possibly damaging Het
Usp19 T C 9: 108,376,130 (GRCm39) L991P possibly damaging Het
Vmn2r109 G A 17: 20,760,973 (GRCm39) P795S possibly damaging Het
Vmn2r26 T C 6: 124,016,741 (GRCm39) Y402H probably benign Het
Vmn2r-ps117 T G 17: 19,045,095 (GRCm39) I504R probably benign Het
Zfp551 A T 7: 12,150,715 (GRCm39) C231* probably null Het
Zfp607a T A 7: 27,577,790 (GRCm39) C287S possibly damaging Het
Zim1 T A 7: 6,690,706 (GRCm39) T40S unknown Het
Other mutations in Sec23ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Sec23ip APN 7 128,369,333 (GRCm39) missense probably damaging 1.00
IGL01347:Sec23ip APN 7 128,364,129 (GRCm39) missense probably benign 0.08
IGL01358:Sec23ip APN 7 128,354,521 (GRCm39) missense possibly damaging 0.68
IGL01656:Sec23ip APN 7 128,351,969 (GRCm39) missense probably damaging 1.00
IGL01835:Sec23ip APN 7 128,357,035 (GRCm39) splice site probably null
IGL02233:Sec23ip APN 7 128,380,903 (GRCm39) missense probably damaging 1.00
IGL02499:Sec23ip APN 7 128,378,640 (GRCm39) missense probably damaging 1.00
IGL03381:Sec23ip APN 7 128,352,029 (GRCm39) missense probably damaging 0.97
R0053:Sec23ip UTSW 7 128,346,891 (GRCm39) missense probably damaging 1.00
R0147:Sec23ip UTSW 7 128,380,775 (GRCm39) splice site probably benign
R0360:Sec23ip UTSW 7 128,363,129 (GRCm39) splice site probably benign
R1427:Sec23ip UTSW 7 128,378,609 (GRCm39) missense probably damaging 0.99
R1442:Sec23ip UTSW 7 128,378,510 (GRCm39) missense probably benign 0.10
R1462:Sec23ip UTSW 7 128,367,862 (GRCm39) missense probably benign
R1462:Sec23ip UTSW 7 128,367,862 (GRCm39) missense probably benign
R1564:Sec23ip UTSW 7 128,368,005 (GRCm39) splice site probably null
R1876:Sec23ip UTSW 7 128,354,575 (GRCm39) missense probably benign
R1966:Sec23ip UTSW 7 128,357,077 (GRCm39) missense probably damaging 0.98
R1977:Sec23ip UTSW 7 128,367,997 (GRCm39) missense probably damaging 1.00
R2115:Sec23ip UTSW 7 128,364,185 (GRCm39) missense probably benign 0.00
R2847:Sec23ip UTSW 7 128,355,797 (GRCm39) missense probably benign 0.00
R3958:Sec23ip UTSW 7 128,378,574 (GRCm39) missense probably benign 0.35
R3959:Sec23ip UTSW 7 128,378,574 (GRCm39) missense probably benign 0.35
R3960:Sec23ip UTSW 7 128,378,574 (GRCm39) missense probably benign 0.35
R4287:Sec23ip UTSW 7 128,379,057 (GRCm39) missense probably benign 0.37
R4510:Sec23ip UTSW 7 128,380,900 (GRCm39) missense probably damaging 1.00
R4511:Sec23ip UTSW 7 128,380,900 (GRCm39) missense probably damaging 1.00
R4612:Sec23ip UTSW 7 128,352,226 (GRCm39) nonsense probably null
R4660:Sec23ip UTSW 7 128,352,010 (GRCm39) missense probably null 0.00
R4890:Sec23ip UTSW 7 128,354,634 (GRCm39) missense probably damaging 0.98
R5287:Sec23ip UTSW 7 128,367,860 (GRCm39) missense probably benign
R5587:Sec23ip UTSW 7 128,352,151 (GRCm39) missense probably benign
R5625:Sec23ip UTSW 7 128,346,707 (GRCm39) unclassified probably benign
R5656:Sec23ip UTSW 7 128,378,508 (GRCm39) missense probably damaging 1.00
R5808:Sec23ip UTSW 7 128,373,908 (GRCm39) missense probably benign 0.00
R6034:Sec23ip UTSW 7 128,351,927 (GRCm39) missense possibly damaging 0.66
R6034:Sec23ip UTSW 7 128,351,927 (GRCm39) missense possibly damaging 0.66
R6145:Sec23ip UTSW 7 128,380,208 (GRCm39) missense probably damaging 0.99
R6747:Sec23ip UTSW 7 128,354,573 (GRCm39) synonymous silent
R6992:Sec23ip UTSW 7 128,367,164 (GRCm39) missense probably benign
R7131:Sec23ip UTSW 7 128,381,364 (GRCm39) missense probably damaging 1.00
R7163:Sec23ip UTSW 7 128,364,257 (GRCm39) critical splice donor site probably null
R7387:Sec23ip UTSW 7 128,346,727 (GRCm39) unclassified probably benign
R7559:Sec23ip UTSW 7 128,379,074 (GRCm39) missense possibly damaging 0.65
R7975:Sec23ip UTSW 7 128,364,201 (GRCm39) missense probably damaging 1.00
R8158:Sec23ip UTSW 7 128,369,364 (GRCm39) missense probably damaging 0.99
R8337:Sec23ip UTSW 7 128,365,749 (GRCm39) missense probably damaging 1.00
R8409:Sec23ip UTSW 7 128,365,855 (GRCm39) missense probably damaging 1.00
R8418:Sec23ip UTSW 7 128,380,187 (GRCm39) missense probably damaging 0.98
R8434:Sec23ip UTSW 7 128,352,151 (GRCm39) missense probably benign
R8461:Sec23ip UTSW 7 128,373,926 (GRCm39) missense probably benign
R8553:Sec23ip UTSW 7 128,355,777 (GRCm39) missense probably damaging 1.00
R8897:Sec23ip UTSW 7 128,354,467 (GRCm39) missense probably benign 0.14
R9059:Sec23ip UTSW 7 128,365,805 (GRCm39) missense probably damaging 1.00
R9142:Sec23ip UTSW 7 128,363,226 (GRCm39) missense probably damaging 1.00
R9674:Sec23ip UTSW 7 128,380,187 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTTACCTGGAAAGACACGTAGG -3'
(R):5'- ATCTGAAAACCTGCACAGATTAAGG -3'

Sequencing Primer
(F):5'- CACGTAGGATAGCTAATACTGATACC -3'
(R):5'- GAATCTGACAGTTGAAAACAAGACC -3'
Posted On 2018-11-28