Incidental Mutation 'R1427:Ganab'
ID161371
Institutional Source Beutler Lab
Gene Symbol Ganab
Ensembl Gene ENSMUSG00000071650
Gene Namealpha glucosidase 2 alpha neutral subunit
SynonymsG2an, GluII
MMRRC Submission 039483-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.903) question?
Stock #R1427 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location8898090-8916663 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8915666 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 945 (T945A)
Ref Sequence ENSEMBL: ENSMUSP00000093965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096243] [ENSMUST00000096246]
Predicted Effect probably benign
Transcript: ENSMUST00000096243
SMART Domains Protein: ENSMUSP00000093962
Gene: ENSMUSG00000071649

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 58 75 N/A INTRINSIC
Pfam:Glyco_transf_43 96 312 1.8e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000096246
AA Change: T945A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000093965
Gene: ENSMUSG00000071650
AA Change: T945A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
low complexity region 157 169 N/A INTRINSIC
Pfam:Gal_mutarotas_2 275 346 3.9e-24 PFAM
Pfam:Glyco_hydro_31 387 832 8.7e-136 PFAM
low complexity region 888 898 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 87.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha subunit of glucosidase II and a member of the glycosyl hydrolase 31 family of proteins. The heterodimeric enzyme glucosidase II plays a role in protein folding and quality control by cleaving glucose residues from immature glycoproteins in the endoplasmic reticulum. Expression of the encoded protein is elevated in lung tumor tissue and in response to UV irradiation. Mutations in this gene cause autosomal-dominant polycystic kidney and liver disease. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 A G 4: 144,623,040 N289S probably damaging Het
Abhd12b A G 12: 70,182,419 D223G probably damaging Het
Agap3 A G 5: 24,476,693 T333A probably benign Het
Arhgap28 C A 17: 67,857,464 Q554H probably damaging Het
Clcnkb A G 4: 141,405,309 L603P probably damaging Het
Dchs1 T C 7: 105,766,191 D626G probably benign Het
Eml3 T C 19: 8,933,861 Y285H probably damaging Het
Iars A T 13: 49,704,269 probably null Het
Kalrn A G 16: 33,975,754 F1217S probably damaging Het
Lipf T C 19: 33,965,600 F103L probably damaging Het
Lpar2 C A 8: 69,824,050 A163E possibly damaging Het
Myh1 T C 11: 67,219,747 Y1495H probably damaging Het
Olfr487 A G 7: 108,212,094 I145T probably benign Het
Ppp3ca T A 3: 136,921,914 L413H probably damaging Het
Ptpn7 T C 1: 135,134,454 V46A possibly damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Sec23ip C T 7: 128,776,885 R808C probably damaging Het
Slc25a26 T C 6: 94,510,847 S96P probably damaging Het
Stard13 G A 5: 151,045,991 R898W probably damaging Het
Tenm4 T C 7: 96,843,048 V1063A probably benign Het
Tm6sf2 T G 8: 70,075,582 M127R probably damaging Het
Ttn A T 2: 76,753,104 W22482R probably damaging Het
Zfp384 T C 6: 125,024,884 L109P probably damaging Het
Other mutations in Ganab
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Ganab APN 19 8902595 missense probably benign
IGL00434:Ganab APN 19 8907343 missense probably damaging 1.00
IGL01415:Ganab APN 19 8914694 splice site probably benign
IGL02418:Ganab APN 19 8911069 missense probably null 0.97
IGL02886:Ganab APN 19 8911027 splice site probably benign
IGL02997:Ganab APN 19 8915412 missense probably benign 0.00
IGL03108:Ganab APN 19 8912476 missense probably damaging 1.00
R0240:Ganab UTSW 19 8912813 missense possibly damaging 0.58
R0240:Ganab UTSW 19 8912813 missense possibly damaging 0.58
R0349:Ganab UTSW 19 8911652 missense probably null 0.11
R0457:Ganab UTSW 19 8907250 missense possibly damaging 0.92
R0551:Ganab UTSW 19 8907280 missense probably benign 0.35
R0645:Ganab UTSW 19 8911113 missense probably damaging 1.00
R0652:Ganab UTSW 19 8915402 critical splice acceptor site probably null
R0688:Ganab UTSW 19 8911113 missense probably damaging 1.00
R0726:Ganab UTSW 19 8911113 missense probably damaging 1.00
R1946:Ganab UTSW 19 8910808 missense probably damaging 1.00
R1955:Ganab UTSW 19 8911616 nonsense probably null
R2173:Ganab UTSW 19 8902260 unclassified probably benign
R2280:Ganab UTSW 19 8909468 missense probably damaging 1.00
R2281:Ganab UTSW 19 8909468 missense probably damaging 1.00
R4897:Ganab UTSW 19 8914991 missense probably benign 0.07
R5224:Ganab UTSW 19 8910591 missense probably benign 0.35
R5269:Ganab UTSW 19 8911937 missense probably damaging 1.00
R5323:Ganab UTSW 19 8908685 missense probably benign 0.00
R5850:Ganab UTSW 19 8911707 missense probably damaging 1.00
R6469:Ganab UTSW 19 8902632 critical splice donor site probably null
R6911:Ganab UTSW 19 8907788 intron probably null
R7284:Ganab UTSW 19 8912540 missense probably damaging 1.00
R7412:Ganab UTSW 19 8912528 missense probably benign 0.01
R7413:Ganab UTSW 19 8904975 missense probably benign 0.01
R7466:Ganab UTSW 19 8914569 nonsense probably null
R7586:Ganab UTSW 19 8911352 missense possibly damaging 0.76
R7657:Ganab UTSW 19 8907357 missense probably damaging 0.99
R7671:Ganab UTSW 19 8912852 missense possibly damaging 0.94
R7729:Ganab UTSW 19 8914712 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- GTGGTGCTCCAGACCAAAGGTTAG -3'
(R):5'- TGTGCTCCAGTTACAGCAACAGG -3'

Sequencing Primer
(F):5'- CTCCAGACCAAAGGTTAGTGATAG -3'
(R):5'- AGGACAGCCCTGTCATCTTG -3'
Posted On2014-03-14