Mutagenetix > Incidental Mutation

Incidental Mutation 'R5587:Sec23ip'

438821

Institutional Source

Beutler Lab

Gene Symbol

Sec23ip

Ensembl Gene

ENSMUSG00000055319

Gene Name

Sec23 interacting protein

Synonyms

D7Ertd373e, p125

MMRRC Submission

043141-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.617) question?

Stock #

R5587 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

128744943-128784836 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 128750427 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Tyrosine at position 176 (H176Y)

Ref Sequence

ENSEMBL: ENSMUSP00000035610 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042942] [ENSMUST00000206986]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000042942
AA Change: H176Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000035610
Gene: ENSMUSG00000055319
AA Change: H176Y

Domain	Start	End	E-Value	Type
low complexity region	8	26	N/A	INTRINSIC
low complexity region	41	51	N/A	INTRINSIC
low complexity region	79	88	N/A	INTRINSIC
low complexity region	203	215	N/A	INTRINSIC
low complexity region	222	230	N/A	INTRINSIC
Blast:DDHD	513	585	8e-33	BLAST
SAM	637	702	2.18e-9	SMART
DDHD	777	987	1.33e-74	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000205856

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206504

Predicted Effect

probably benign
Transcript: ENSMUST00000206986

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.9%

Validation Efficiency

96% (78/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phosphatidic acid preferring-phospholipase A1 family. The encoded protein is localized to endoplasmic reticulum exit sites and plays a critical role in ER-Golgi transport as part of the multimeric coat protein II complex. An orthologous gene in frogs is required for normal neural crest cell development, suggesting that this gene may play a role in Waardenburg syndrome neural crest defects. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Male mice homozygous for a null allele display reduced fertility with globozoospermia and impaired fertilization. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,065,409	R120G	probably benign	Het
4930548H24Rik	G	T	5: 31,486,084	G53W	probably benign	Het
Acad11	A	G	9: 104,063,767	T3A	probably benign	Het
Adamts18	G	A	8: 113,775,360	Q290*	probably null	Het
Ahnak	A	G	19: 9,009,476	D2708G	possibly damaging	Het
Asxl3	T	A	18: 22,525,247	C2105S	probably benign	Het
Atp8b1	A	T	18: 64,539,210	F1028I	probably damaging	Het
Axdnd1	C	G	1: 156,351,412	W615C	probably damaging	Het
Bcl3	A	T	7: 19,809,634	Y10*	probably null	Het
Bmp2	T	A	2: 133,554,646	V74E	possibly damaging	Het
Ccdc109b	A	C	3: 129,916,970	V271G	probably benign	Het
Ccdc78	C	A	17: 25,786,677	P21Q	probably benign	Het
Cluap1	T	A	16: 3,915,484	V199E	probably damaging	Het
Cntnap3	T	C	13: 64,746,738	E1120G	probably damaging	Het
Col1a2	T	A	6: 4,540,531	W1330R	unknown	Het
Coq4	A	G	2: 29,795,514		probably null	Het
Cwf19l1	G	A	19: 44,120,877	T346I	possibly damaging	Het
Cyct	T	C	2: 76,354,203	Y68C	probably damaging	Het
Dnah10	T	C	5: 124,793,913	L2368P	probably benign	Het
Dnah2	A	T	11: 69,437,242	F3346I	probably damaging	Het
Dpp3	A	T	19: 4,918,267	V259E	probably damaging	Het
Dpyd	A	C	3: 119,064,951	S605R	probably damaging	Het
Emc1	A	G	4: 139,362,148	E209G	probably damaging	Het
Esrra	A	G	19: 6,920,207	S61P	probably benign	Het
Fam71d	C	A	12: 78,715,075	P171H	probably damaging	Het
Gbx2	T	A	1: 89,933,122		probably benign	Het
Hepacam	A	G	9: 37,384,684	H377R	probably damaging	Het
Igkv12-46	T	C	6: 69,764,550	Y107C	probably damaging	Het
Intu	A	G	3: 40,675,308	D356G	probably damaging	Het
Izumo4	A	T	10: 80,703,220	N113Y	probably damaging	Het
Krt86	G	A	15: 101,473,593	A15T	probably benign	Het
Lhx8	A	T	3: 154,311,679	S275R	probably damaging	Het
Lingo3	A	T	10: 80,835,530	S189T	probably damaging	Het
Llgl1	T	A	11: 60,710,342	M702K	probably benign	Het
Lpin1	T	C	12: 16,573,714	Y223C		Het
Lrit3	G	T	3: 129,788,898	A359E	probably benign	Het
Lrp2	T	C	2: 69,499,263	E1720G	probably benign	Het
Nktr	C	T	9: 121,748,489		probably benign	Het
Olfr1342	T	A	4: 118,689,870	D194V	probably damaging	Het
Olfr1502	G	A	19: 13,862,576	R261H	probably damaging	Het
Olfr347	A	T	2: 36,734,621	Q100L	probably damaging	Het
Olfr617	T	A	7: 103,584,531	Y170N	probably benign	Het
Olfr979	A	T	9: 40,000,621	I202N	possibly damaging	Het
Olfr984	A	T	9: 40,101,244	L82Q	probably damaging	Het
Pcdha4	T	C	18: 36,954,822	V686A	probably benign	Het
Pelo	A	G	13: 115,089,873	V16A	possibly damaging	Het
Plcd1	A	G	9: 119,073,832	S539P	probably benign	Het
Prss1	A	G	6: 41,463,265	I179V	possibly damaging	Het
Ptgs2	T	C	1: 150,105,555	Y530H	probably damaging	Het
Rai1	T	C	11: 60,189,859	V1583A	probably damaging	Het
Raph1	T	G	1: 60,498,473	D508A	probably damaging	Het
Rmnd5a	A	G	6: 71,394,619		probably benign	Het
Rsf1	T	C	7: 97,662,121	L686P	probably benign	Het
Samd9l	T	C	6: 3,373,291	I1323M	possibly damaging	Het
Scn1a	T	C	2: 66,273,081	N1934S	probably benign	Het
Sh3glb2	A	G	2: 30,354,851		probably null	Het
Sis	A	G	3: 72,914,576	I1384T	possibly damaging	Het
Spata31d1a	A	C	13: 59,702,618	C565W	probably damaging	Het
Srbd1	T	A	17: 86,127,801	Q278L	probably damaging	Het
Sry	T	C	Y: 2,662,625	H345R	unknown	Het
Suox	A	T	10: 128,671,825	D111E	probably damaging	Het
Taar7a	A	T	10: 23,992,828	F218L	probably benign	Het
Tfcp2l1	C	A	1: 118,664,762	N288K	possibly damaging	Het
Tmem128	G	T	5: 38,260,421	R7L	possibly damaging	Het
Tmem266	A	G	9: 55,437,566	N494S	probably damaging	Het
Tmprss3	T	A	17: 31,193,992	H80L	probably benign	Het
Tnrc6c	C	T	11: 117,749,271	Q1211*	probably null	Het
Tns1	T	A	1: 73,920,596	D1671V	possibly damaging	Het
Trmt1l	T	A	1: 151,435,704		probably benign	Het
Tshz2	A	T	2: 169,884,342	D286V	probably damaging	Het
Ttyh2	A	G	11: 114,675,659	E39G	probably benign	Het
Vmn2r125	G	A	4: 156,350,138	C73Y	probably damaging	Het
Vmn2r5	T	C	3: 64,504,076	D357G	probably damaging	Het
Vmn2r61	T	C	7: 42,300,487	F777S	probably damaging	Het
Vmn2r9	T	C	5: 108,847,561	E407G	probably damaging	Het
Vwa3a	A	G	7: 120,780,235	N521S	probably damaging	Het
Zan	C	G	5: 137,391,762	S4816T	unknown	Het
Zc3h7b	T	C	15: 81,771,858	Y136H	possibly damaging	Het
Zfp101	T	C	17: 33,381,321	K487R	possibly damaging	Het

Other mutations in Sec23ip

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00825:Sec23ip	APN	7	128767609	missense	probably damaging	1.00
IGL01347:Sec23ip	APN	7	128762405	missense	probably benign	0.08
IGL01358:Sec23ip	APN	7	128752797	missense	possibly damaging	0.68
IGL01656:Sec23ip	APN	7	128750245	missense	probably damaging	1.00
IGL01835:Sec23ip	APN	7	128755311	splice site	probably null
IGL02233:Sec23ip	APN	7	128779179	missense	probably damaging	1.00
IGL02499:Sec23ip	APN	7	128776916	missense	probably damaging	1.00
IGL03381:Sec23ip	APN	7	128750305	missense	probably damaging	0.97
R0053:Sec23ip	UTSW	7	128745167	missense	probably damaging	1.00
R0147:Sec23ip	UTSW	7	128779051	splice site	probably benign
R0360:Sec23ip	UTSW	7	128761405	splice site	probably benign
R1427:Sec23ip	UTSW	7	128776885	missense	probably damaging	0.99
R1442:Sec23ip	UTSW	7	128776786	missense	probably benign	0.10
R1462:Sec23ip	UTSW	7	128766138	missense	probably benign
R1462:Sec23ip	UTSW	7	128766138	missense	probably benign
R1564:Sec23ip	UTSW	7	128766281	splice site	probably null
R1876:Sec23ip	UTSW	7	128752851	missense	probably benign
R1966:Sec23ip	UTSW	7	128755353	missense	probably damaging	0.98
R1977:Sec23ip	UTSW	7	128766273	missense	probably damaging	1.00
R2115:Sec23ip	UTSW	7	128762461	missense	probably benign	0.00
R2847:Sec23ip	UTSW	7	128754073	missense	probably benign	0.00
R3958:Sec23ip	UTSW	7	128776850	missense	probably benign	0.35
R3959:Sec23ip	UTSW	7	128776850	missense	probably benign	0.35
R3960:Sec23ip	UTSW	7	128776850	missense	probably benign	0.35
R4287:Sec23ip	UTSW	7	128777333	missense	probably benign	0.37
R4510:Sec23ip	UTSW	7	128779176	missense	probably damaging	1.00
R4511:Sec23ip	UTSW	7	128779176	missense	probably damaging	1.00
R4612:Sec23ip	UTSW	7	128750502	nonsense	probably null
R4660:Sec23ip	UTSW	7	128750286	missense	probably null	0.00
R4890:Sec23ip	UTSW	7	128752910	missense	probably damaging	0.98
R5287:Sec23ip	UTSW	7	128766136	missense	probably benign
R5625:Sec23ip	UTSW	7	128744983	unclassified	probably benign
R5656:Sec23ip	UTSW	7	128776784	missense	probably damaging	1.00
R5808:Sec23ip	UTSW	7	128772184	missense	probably benign	0.00
R6034:Sec23ip	UTSW	7	128750203	missense	possibly damaging	0.66
R6034:Sec23ip	UTSW	7	128750203	missense	possibly damaging	0.66
R6145:Sec23ip	UTSW	7	128778484	missense	probably damaging	0.99
R6747:Sec23ip	UTSW	7	128752849	synonymous	silent
R6953:Sec23ip	UTSW	7	128752796	nonsense	probably null
R6992:Sec23ip	UTSW	7	128765440	missense	probably benign
R7131:Sec23ip	UTSW	7	128779640	missense	probably damaging	1.00
R7163:Sec23ip	UTSW	7	128762533	critical splice donor site	probably null
R7387:Sec23ip	UTSW	7	128745003	unclassified	probably benign
R7559:Sec23ip	UTSW	7	128777350	missense	possibly damaging	0.65
R7975:Sec23ip	UTSW	7	128762477	missense	probably damaging	1.00
R8158:Sec23ip	UTSW	7	128767640	missense	probably damaging	0.99
R8337:Sec23ip	UTSW	7	128764025	missense	probably damaging	1.00
R8409:Sec23ip	UTSW	7	128764131	missense	probably damaging	1.00
R8418:Sec23ip	UTSW	7	128778463	missense	probably damaging	0.98
R8434:Sec23ip	UTSW	7	128750427	missense	probably benign
R8461:Sec23ip	UTSW	7	128772202	missense	probably benign
R8553:Sec23ip	UTSW	7	128754053	missense	probably damaging	1.00
R8897:Sec23ip	UTSW	7	128752743	missense	probably benign	0.14
R9059:Sec23ip	UTSW	7	128764081	missense	probably damaging	1.00
R9142:Sec23ip	UTSW	7	128761502	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGACGACTTCAGCAATGTCAG -3'
(R):5'- ATTCGCATACCGGTGGCAATG -3'

Sequencing Primer
(F):5'- TGGACAGTCAGCACTTCCC -3'
(R):5'- ATACCGGTGGCAATGGTCCAG -3'

Posted On

2016-10-26