Incidental Mutation 'R1392:Tmcc1'
ID165973
Institutional Source Beutler Lab
Gene Symbol Tmcc1
Ensembl Gene ENSMUSG00000030126
Gene Nametransmembrane and coiled coil domains 1
Synonyms
MMRRC Submission 039454-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.260) question?
Stock #R1392 (G1)
Quality Score110
Status Not validated
Chromosome6
Chromosomal Location116018611-116193486 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 116022110 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 323 (R323G)
Ref Sequence ENSEMBL: ENSMUSP00000134455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088896] [ENSMUST00000172510] [ENSMUST00000173110] [ENSMUST00000173140] [ENSMUST00000173548] [ENSMUST00000204353]
Predicted Effect unknown
Transcript: ENSMUST00000032222
AA Change: R683G
SMART Domains Protein: ENSMUSP00000032222
Gene: ENSMUSG00000030126
AA Change: R683G

DomainStartEndE-ValueType
low complexity region 153 164 N/A INTRINSIC
Pfam:Tmemb_cc2 268 677 9.7e-170 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000088896
AA Change: R643G

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000086285
Gene: ENSMUSG00000030126
AA Change: R643G

DomainStartEndE-ValueType
low complexity region 156 167 N/A INTRINSIC
Pfam:Tmemb_cc2 227 636 2.3e-170 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172510
AA Change: R323G

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133665
Gene: ENSMUSG00000030126
AA Change: R323G

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 1 188 6.5e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173110
SMART Domains Protein: ENSMUSP00000133794
Gene: ENSMUSG00000030126

DomainStartEndE-ValueType
low complexity region 156 167 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000173140
AA Change: R323G

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134455
Gene: ENSMUSG00000030126
AA Change: R323G

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 1 79 6.1e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173548
AA Change: R464G

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000145456
Gene: ENSMUSG00000030126
AA Change: R464G

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 48 457 1.5e-167 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000204353
AA Change: R468G

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144971
Gene: ENSMUSG00000030126
AA Change: R468G

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 52 461 8.3e-171 PFAM
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.6%
  • 10x: 94.0%
  • 20x: 82.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Csf1 A G 3: 107,756,630 V74A probably benign Het
Hnrnpm A T 17: 33,658,415 S325T possibly damaging Het
Hunk T C 16: 90,472,464 S299P probably damaging Het
Kcnk4 C T 19: 6,927,663 V207I possibly damaging Het
Mettl7b T C 10: 128,960,698 T81A possibly damaging Het
Myo15 A G 11: 60,477,974 H520R possibly damaging Het
Olfr310 A T 7: 86,268,855 F311L probably benign Het
Olfr351 A T 2: 36,860,175 Y58N probably damaging Het
Phc2 A G 4: 128,745,087 H607R possibly damaging Het
Rsad2 A G 12: 26,445,440 V352A probably benign Het
Rtn4rl2 A G 2: 84,880,512 L136P probably damaging Het
Spef2 C T 15: 9,647,263 V993I probably benign Het
Tiam2 A G 17: 3,414,197 H67R possibly damaging Het
Tmem246 A G 4: 49,586,919 L83P probably damaging Het
Vmn2r65 A T 7: 84,947,416 S144T probably benign Het
Vmn2r77 A G 7: 86,801,622 T239A probably benign Het
Other mutations in Tmcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Tmcc1 APN 6 116043027 missense probably damaging 0.99
IGL01580:Tmcc1 APN 6 116042985 missense possibly damaging 0.91
IGL02858:Tmcc1 APN 6 116133888 missense probably damaging 0.99
IGL03226:Tmcc1 APN 6 116133976 missense probably damaging 0.99
Dominus_dei UTSW 6 116134237 nonsense probably null
FR4976:Tmcc1 UTSW 6 116193380 start gained probably benign
IGL02988:Tmcc1 UTSW 6 116042928 missense probably damaging 1.00
PIT4581001:Tmcc1 UTSW 6 116043456 missense
R0522:Tmcc1 UTSW 6 116042870 frame shift probably null
R0654:Tmcc1 UTSW 6 116042990 missense probably benign 0.03
R0721:Tmcc1 UTSW 6 116042870 frame shift probably null
R1573:Tmcc1 UTSW 6 116133963 missense probably damaging 0.99
R1644:Tmcc1 UTSW 6 116133865 missense probably damaging 1.00
R2062:Tmcc1 UTSW 6 116043058 missense probably benign 0.01
R2065:Tmcc1 UTSW 6 116042870 frame shift probably null
R2214:Tmcc1 UTSW 6 116042870 frame shift probably null
R2240:Tmcc1 UTSW 6 116042870 frame shift probably null
R2399:Tmcc1 UTSW 6 116042870 frame shift probably null
R3683:Tmcc1 UTSW 6 116042870 frame shift probably null
R3722:Tmcc1 UTSW 6 116133822 missense possibly damaging 0.83
R3926:Tmcc1 UTSW 6 116042913 missense probably damaging 1.00
R4082:Tmcc1 UTSW 6 116043480 missense probably damaging 1.00
R4155:Tmcc1 UTSW 6 116133804 missense probably benign 0.18
R4619:Tmcc1 UTSW 6 116043286 missense probably damaging 1.00
R5246:Tmcc1 UTSW 6 116043420 missense probably damaging 1.00
R5568:Tmcc1 UTSW 6 116022110 missense possibly damaging 0.84
R6364:Tmcc1 UTSW 6 116043761 start gained probably benign
R7238:Tmcc1 UTSW 6 116134237 nonsense probably null
R7257:Tmcc1 UTSW 6 116107338 missense probably benign 0.27
R7603:Tmcc1 UTSW 6 116043131 nonsense probably null
R7693:Tmcc1 UTSW 6 116024882 missense
R7694:Tmcc1 UTSW 6 116133844 missense
R7698:Tmcc1 UTSW 6 116043802 nonsense probably null
R7798:Tmcc1 UTSW 6 116043578 missense
R8158:Tmcc1 UTSW 6 116043474 missense
Predicted Primers PCR Primer
(F):5'- TTCCACGGCAGGGAAAATCCAC -3'
(R):5'- CCGAAACCTTCTGGGCAAACTCATC -3'

Sequencing Primer
(F):5'- CAATTCAGAATGCCCTTCAGTGTG -3'
(R):5'- CTTCTGGGCAAACTCATCAATATC -3'
Posted On2014-03-28