Incidental Mutation 'R1739:Cacna1c'
ID200178
Institutional Source Beutler Lab
Gene Symbol Cacna1c
Ensembl Gene ENSMUSG00000051331
Gene Namecalcium channel, voltage-dependent, L type, alpha 1C subunit
SynonymsCav1.2, D930026N18Rik, Cchl1a1, (alpha)1 subunit, L-type Cav1.2
MMRRC Submission 039771-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.397) question?
Stock #R1739 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location118587240-119196418 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 118610544 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 1287 (M1287R)
Ref Sequence ENSEMBL: ENSMUSP00000108444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075591] [ENSMUST00000078320] [ENSMUST00000112790] [ENSMUST00000112793] [ENSMUST00000112825] [ENSMUST00000185345] [ENSMUST00000186889] [ENSMUST00000187317] [ENSMUST00000187386] [ENSMUST00000187474] [ENSMUST00000187940] [ENSMUST00000188078] [ENSMUST00000188106] [ENSMUST00000188522] [ENSMUST00000188865] [ENSMUST00000189389] [ENSMUST00000189520] [ENSMUST00000190285] [ENSMUST00000219018] [ENSMUST00000219223] [ENSMUST00000219833] [ENSMUST00000220022]
Predicted Effect probably benign
Transcript: ENSMUST00000075591
AA Change: M1557R

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000075021
Gene: ENSMUSG00000051331
AA Change: M1557R

DomainStartEndE-ValueType
Pfam:Ion_trans 2 245 3.5e-60 PFAM
PDB:4DEY|B 246 369 2e-57 PDB
low complexity region 370 384 N/A INTRINSIC
transmembrane domain 390 409 N/A INTRINSIC
Pfam:Ion_trans 424 618 1.3e-46 PFAM
low complexity region 633 643 N/A INTRINSIC
low complexity region 663 675 N/A INTRINSIC
low complexity region 711 718 N/A INTRINSIC
transmembrane domain 762 784 N/A INTRINSIC
Pfam:Ion_trans 801 1031 2.6e-51 PFAM
Pfam:PKD_channel 1095 1348 2.7e-10 PFAM
Pfam:Ion_trans 1119 1341 3.9e-70 PFAM
Blast:EFh 1362 1390 4e-9 BLAST
Ca_chan_IQ 1476 1510 3.28e-15 SMART
low complexity region 1630 1640 N/A INTRINSIC
low complexity region 1810 1824 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078320
AA Change: M1557R

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000077433
Gene: ENSMUSG00000051331
AA Change: M1557R

DomainStartEndE-ValueType
Pfam:Ion_trans 2 245 1.4e-59 PFAM
PDB:4DEY|B 246 344 4e-63 PDB
low complexity region 345 359 N/A INTRINSIC
transmembrane domain 365 384 N/A INTRINSIC
Pfam:Ion_trans 399 593 5.2e-46 PFAM
low complexity region 608 618 N/A INTRINSIC
low complexity region 638 650 N/A INTRINSIC
low complexity region 686 693 N/A INTRINSIC
transmembrane domain 737 759 N/A INTRINSIC
Pfam:Ion_trans 776 1006 2.5e-51 PFAM
Pfam:PKD_channel 1070 1323 1.1e-9 PFAM
Pfam:Ion_trans 1094 1316 1.5e-69 PFAM
Blast:EFh 1337 1365 4e-9 BLAST
Ca_chan_IQ 1451 1485 3.28e-15 SMART
low complexity region 1605 1615 N/A INTRINSIC
low complexity region 1785 1799 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112790
AA Change: M1557R

PolyPhen 2 Score 0.445 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108410
Gene: ENSMUSG00000051331
AA Change: M1557R

DomainStartEndE-ValueType
Pfam:Ion_trans 2 245 5.7e-60 PFAM
PDB:4DEY|B 246 344 4e-63 PDB
low complexity region 345 359 N/A INTRINSIC
transmembrane domain 365 384 N/A INTRINSIC
Pfam:Ion_trans 399 593 2.1e-46 PFAM
low complexity region 608 618 N/A INTRINSIC
low complexity region 638 650 N/A INTRINSIC
low complexity region 686 693 N/A INTRINSIC
transmembrane domain 737 759 N/A INTRINSIC
Pfam:Ion_trans 776 1006 1e-51 PFAM
Pfam:Ion_trans 1094 1305 1.1e-66 PFAM
Pfam:PKD_channel 1140 1312 1.3e-8 PFAM
Blast:EFh 1326 1354 4e-9 BLAST
Ca_chan_IQ 1440 1474 3.28e-15 SMART
low complexity region 1594 1604 N/A INTRINSIC
low complexity region 1774 1788 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112793
AA Change: M1640R

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000108413
Gene: ENSMUSG00000051331
AA Change: M1640R

DomainStartEndE-ValueType
Pfam:Ion_trans 1 257 1.8e-64 PFAM
Pfam:PKD_channel 379 624 5.8e-8 PFAM
Pfam:Ion_trans 389 630 5e-56 PFAM
low complexity region 633 643 N/A INTRINSIC
low complexity region 663 675 N/A INTRINSIC
low complexity region 711 718 N/A INTRINSIC
Pfam:Ion_trans 765 1043 8.7e-64 PFAM
Pfam:Ion_trans 1084 1411 6.4e-69 PFAM
Pfam:PKD_channel 1234 1406 9.2e-9 PFAM
Pfam:GPHH 1413 1482 7.7e-40 PFAM
Ca_chan_IQ 1534 1568 3.28e-15 SMART
Pfam:CAC1F_C 1577 2060 3.5e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112825
AA Change: M1287R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108444
Gene: ENSMUSG00000051331
AA Change: M1287R

DomainStartEndE-ValueType
Pfam:Ion_trans 1 140 1.8e-31 PFAM
PDB:4DEY|B 141 264 1e-54 PDB
low complexity region 265 279 N/A INTRINSIC
Pfam:Ion_trans 319 513 2e-46 PFAM
low complexity region 528 538 N/A INTRINSIC
low complexity region 558 570 N/A INTRINSIC
low complexity region 606 613 N/A INTRINSIC
Pfam:Ion_trans 659 906 1e-43 PFAM
Pfam:Ion_trans 994 1205 7.1e-70 PFAM
Pfam:PKD_channel 1041 1212 1.6e-8 PFAM
Blast:EFh 1226 1254 4e-9 BLAST
Ca_chan_IQ 1340 1374 3.28e-15 SMART
low complexity region 1494 1504 N/A INTRINSIC
low complexity region 1674 1688 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185345
AA Change: M1577R

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000140833
Gene: ENSMUSG00000051331
AA Change: M1577R

DomainStartEndE-ValueType
low complexity region 26 39 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Pfam:Ion_trans 161 404 8.6e-60 PFAM
PDB:4DEY|B 405 503 3e-63 PDB
low complexity region 504 518 N/A INTRINSIC
transmembrane domain 524 543 N/A INTRINSIC
Pfam:Ion_trans 558 752 1.4e-44 PFAM
low complexity region 767 777 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 845 852 N/A INTRINSIC
transmembrane domain 896 918 N/A INTRINSIC
transmembrane domain 931 953 N/A INTRINSIC
Pfam:Ion_trans 955 1185 2.2e-50 PFAM
Pfam:PKD_channel 1250 1502 6.9e-9 PFAM
Pfam:Ion_trans 1273 1495 6.4e-65 PFAM
Blast:EFh 1516 1544 5e-9 BLAST
Ca_chan_IQ 1630 1664 2.5e-19 SMART
low complexity region 1784 1794 N/A INTRINSIC
low complexity region 1964 1978 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186889
AA Change: M1587R

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000140056
Gene: ENSMUSG00000051331
AA Change: M1587R

DomainStartEndE-ValueType
low complexity region 56 69 N/A INTRINSIC
Pfam:Ion_trans 191 434 1.5e-59 PFAM
PDB:4DEY|B 435 533 5e-63 PDB
low complexity region 534 548 N/A INTRINSIC
Pfam:Ion_trans 588 782 5.6e-46 PFAM
low complexity region 797 807 N/A INTRINSIC
low complexity region 827 839 N/A INTRINSIC
low complexity region 875 882 N/A INTRINSIC
transmembrane domain 926 948 N/A INTRINSIC
Pfam:Ion_trans 965 1195 2.7e-51 PFAM
Pfam:PKD_channel 1261 1512 1.3e-9 PFAM
Pfam:Ion_trans 1283 1505 1.7e-69 PFAM
Blast:EFh 1526 1554 5e-9 BLAST
Ca_chan_IQ 1640 1674 3.28e-15 SMART
low complexity region 1794 1804 N/A INTRINSIC
low complexity region 1974 1988 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187317
AA Change: M1605R

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000140693
Gene: ENSMUSG00000051331
AA Change: M1605R

DomainStartEndE-ValueType
low complexity region 26 39 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Pfam:Ion_trans 161 404 8.8e-60 PFAM
PDB:4DEY|B 405 503 2e-63 PDB
low complexity region 504 518 N/A INTRINSIC
transmembrane domain 524 543 N/A INTRINSIC
Pfam:Ion_trans 558 752 1.5e-44 PFAM
low complexity region 767 777 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 845 852 N/A INTRINSIC
transmembrane domain 896 918 N/A INTRINSIC
transmembrane domain 931 953 N/A INTRINSIC
Pfam:Ion_trans 955 1185 2.3e-50 PFAM
Pfam:PKD_channel 1249 1530 8.3e-8 PFAM
Pfam:Ion_trans 1273 1326 5e-16 PFAM
Pfam:Ion_trans 1323 1523 2.5e-56 PFAM
Blast:EFh 1544 1572 5e-9 BLAST
Ca_chan_IQ 1658 1692 2.5e-19 SMART
low complexity region 1812 1822 N/A INTRINSIC
low complexity region 1992 2006 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000187386
AA Change: M1553R

PolyPhen 2 Score 0.844 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140341
Gene: ENSMUSG00000051331
AA Change: M1553R

DomainStartEndE-ValueType
transmembrane domain 96 118 N/A INTRINSIC
Pfam:Ion_trans 132 375 8.5e-60 PFAM
PDB:4DEY|B 376 499 1e-57 PDB
low complexity region 500 514 N/A INTRINSIC
transmembrane domain 520 539 N/A INTRINSIC
Pfam:Ion_trans 554 748 1.4e-44 PFAM
low complexity region 763 773 N/A INTRINSIC
low complexity region 793 805 N/A INTRINSIC
low complexity region 841 848 N/A INTRINSIC
transmembrane domain 892 914 N/A INTRINSIC
Pfam:Ion_trans 931 1161 2.9e-49 PFAM
Pfam:PKD_channel 1226 1478 6.8e-9 PFAM
Pfam:Ion_trans 1249 1471 6.3e-65 PFAM
Blast:EFh 1492 1520 4e-9 BLAST
Ca_chan_IQ 1606 1640 2.5e-19 SMART
low complexity region 1760 1770 N/A INTRINSIC
low complexity region 1940 1954 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187474
AA Change: M1587R

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000140961
Gene: ENSMUSG00000051331
AA Change: M1587R

DomainStartEndE-ValueType
low complexity region 56 69 N/A INTRINSIC
Pfam:Ion_trans 191 434 7.6e-60 PFAM
PDB:4DEY|B 435 533 4e-63 PDB
low complexity region 534 548 N/A INTRINSIC
Pfam:Ion_trans 588 782 2.8e-46 PFAM
low complexity region 797 807 N/A INTRINSIC
low complexity region 827 839 N/A INTRINSIC
low complexity region 875 882 N/A INTRINSIC
transmembrane domain 926 948 N/A INTRINSIC
Pfam:Ion_trans 965 1195 5.6e-51 PFAM
Pfam:PKD_channel 1261 1512 7.3e-10 PFAM
Pfam:Ion_trans 1283 1505 8.3e-70 PFAM
Blast:EFh 1526 1554 5e-9 BLAST
Ca_chan_IQ 1640 1674 3.28e-15 SMART
low complexity region 1794 1804 N/A INTRINSIC
low complexity region 1974 1988 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187849
Predicted Effect probably benign
Transcript: ENSMUST00000187940
AA Change: M1587R

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000141033
Gene: ENSMUSG00000051331
AA Change: M1587R

DomainStartEndE-ValueType
low complexity region 56 69 N/A INTRINSIC
Pfam:Ion_trans 191 434 7.6e-60 PFAM
PDB:4DEY|B 435 533 4e-63 PDB
low complexity region 534 548 N/A INTRINSIC
Pfam:Ion_trans 588 782 2.8e-46 PFAM
low complexity region 797 807 N/A INTRINSIC
low complexity region 827 839 N/A INTRINSIC
low complexity region 875 882 N/A INTRINSIC
transmembrane domain 926 948 N/A INTRINSIC
Pfam:Ion_trans 965 1195 5.6e-51 PFAM
Pfam:PKD_channel 1260 1512 5.8e-11 PFAM
Pfam:Ion_trans 1283 1505 1.2e-66 PFAM
Blast:EFh 1526 1554 5e-9 BLAST
Ca_chan_IQ 1640 1674 3.28e-15 SMART
low complexity region 1794 1804 N/A INTRINSIC
low complexity region 1974 1988 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188078
AA Change: M1557R

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000140415
Gene: ENSMUSG00000051331
AA Change: M1557R

DomainStartEndE-ValueType
low complexity region 26 39 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Pfam:Ion_trans 161 404 8.5e-60 PFAM
PDB:4DEY|B 405 503 5e-63 PDB
low complexity region 504 518 N/A INTRINSIC
transmembrane domain 524 543 N/A INTRINSIC
Pfam:Ion_trans 558 752 1.4e-44 PFAM
low complexity region 767 777 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 845 852 N/A INTRINSIC
transmembrane domain 896 918 N/A INTRINSIC
Pfam:Ion_trans 935 1165 6.9e-50 PFAM
Pfam:PKD_channel 1230 1482 9e-8 PFAM
Pfam:Ion_trans 1253 1475 4.3e-68 PFAM
Blast:EFh 1496 1524 4e-9 BLAST
Ca_chan_IQ 1610 1644 2.5e-19 SMART
low complexity region 1764 1774 N/A INTRINSIC
low complexity region 1944 1958 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188106
AA Change: M1571R

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000140886
Gene: ENSMUSG00000051331
AA Change: M1571R

DomainStartEndE-ValueType
low complexity region 26 39 N/A INTRINSIC
Pfam:Ion_trans 161 404 8.5e-62 PFAM
PDB:4DEY|B 405 528 2e-57 PDB
low complexity region 529 543 N/A INTRINSIC
Pfam:Ion_trans 583 777 1.4e-46 PFAM
low complexity region 792 802 N/A INTRINSIC
low complexity region 822 834 N/A INTRINSIC
low complexity region 870 877 N/A INTRINSIC
transmembrane domain 921 943 N/A INTRINSIC
Pfam:Ion_trans 960 1190 2.9e-51 PFAM
Pfam:Ion_trans 1278 1489 5.2e-70 PFAM
Pfam:PKD_channel 1325 1496 4.8e-9 PFAM
Blast:EFh 1510 1538 5e-9 BLAST
Ca_chan_IQ 1624 1658 3.28e-15 SMART
low complexity region 1778 1788 N/A INTRINSIC
low complexity region 1958 1972 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188181
Predicted Effect possibly damaging
Transcript: ENSMUST00000188522
AA Change: M1582R

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140920
Gene: ENSMUSG00000051331
AA Change: M1582R

DomainStartEndE-ValueType
low complexity region 26 39 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Pfam:Ion_trans 161 404 8.7e-60 PFAM
PDB:4DEY|B 405 528 2e-57 PDB
low complexity region 529 543 N/A INTRINSIC
transmembrane domain 549 568 N/A INTRINSIC
Pfam:Ion_trans 583 777 1.4e-44 PFAM
low complexity region 792 802 N/A INTRINSIC
low complexity region 822 834 N/A INTRINSIC
low complexity region 870 877 N/A INTRINSIC
transmembrane domain 921 943 N/A INTRINSIC
Pfam:Ion_trans 960 1190 2.9e-49 PFAM
Pfam:PKD_channel 1255 1507 7e-9 PFAM
Pfam:Ion_trans 1278 1500 6.4e-65 PFAM
Blast:EFh 1521 1549 5e-9 BLAST
Ca_chan_IQ 1635 1669 2.5e-19 SMART
low complexity region 1789 1799 N/A INTRINSIC
low complexity region 1969 1983 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188865
AA Change: M1557R

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139981
Gene: ENSMUSG00000051331
AA Change: M1557R

DomainStartEndE-ValueType
low complexity region 26 39 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Pfam:Ion_trans 161 404 8.5e-60 PFAM
PDB:4DEY|B 405 503 5e-63 PDB
low complexity region 504 518 N/A INTRINSIC
transmembrane domain 524 543 N/A INTRINSIC
Pfam:Ion_trans 558 752 1.4e-44 PFAM
low complexity region 767 777 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 845 852 N/A INTRINSIC
transmembrane domain 896 918 N/A INTRINSIC
Pfam:Ion_trans 935 1165 6.9e-50 PFAM
Pfam:PKD_channel 1230 1482 6.8e-9 PFAM
Pfam:Ion_trans 1253 1475 6.3e-65 PFAM
Blast:EFh 1496 1524 4e-9 BLAST
Ca_chan_IQ 1610 1644 2.5e-19 SMART
low complexity region 1764 1774 N/A INTRINSIC
low complexity region 1944 1958 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189389
AA Change: M1585R

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000139855
Gene: ENSMUSG00000051331
AA Change: M1585R

DomainStartEndE-ValueType
low complexity region 26 39 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Pfam:Ion_trans 161 404 8.7e-60 PFAM
PDB:4DEY|B 405 503 4e-63 PDB
low complexity region 504 518 N/A INTRINSIC
transmembrane domain 524 543 N/A INTRINSIC
Pfam:Ion_trans 558 752 1.5e-44 PFAM
low complexity region 767 777 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 845 852 N/A INTRINSIC
transmembrane domain 896 918 N/A INTRINSIC
Pfam:Ion_trans 935 1165 3e-49 PFAM
Pfam:PKD_channel 1229 1510 8.2e-8 PFAM
Pfam:Ion_trans 1253 1306 5e-16 PFAM
Pfam:Ion_trans 1303 1503 2.5e-56 PFAM
Blast:EFh 1524 1552 5e-9 BLAST
Ca_chan_IQ 1638 1672 2.5e-19 SMART
low complexity region 1792 1802 N/A INTRINSIC
low complexity region 1972 1986 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189520
AA Change: M1574R

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000140220
Gene: ENSMUSG00000051331
AA Change: M1574R

DomainStartEndE-ValueType
low complexity region 26 39 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Pfam:Ion_trans 161 404 8.6e-60 PFAM
PDB:4DEY|B 405 503 4e-63 PDB
low complexity region 504 518 N/A INTRINSIC
transmembrane domain 524 543 N/A INTRINSIC
Pfam:Ion_trans 558 752 1.4e-44 PFAM
low complexity region 767 777 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 845 852 N/A INTRINSIC
transmembrane domain 896 918 N/A INTRINSIC
Pfam:Ion_trans 935 1165 7e-50 PFAM
Pfam:PKD_channel 1229 1499 2.2e-9 PFAM
Pfam:Ion_trans 1253 1305 6.6e-16 PFAM
Pfam:Ion_trans 1301 1492 1.1e-56 PFAM
Blast:EFh 1513 1541 5e-9 BLAST
Ca_chan_IQ 1627 1661 2.5e-19 SMART
low complexity region 1781 1791 N/A INTRINSIC
low complexity region 1961 1975 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000190285
AA Change: M1612R

PolyPhen 2 Score 0.470 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141015
Gene: ENSMUSG00000051331
AA Change: M1612R

DomainStartEndE-ValueType
low complexity region 56 69 N/A INTRINSIC
transmembrane domain 155 177 N/A INTRINSIC
Pfam:Ion_trans 191 434 4e-58 PFAM
PDB:4DEY|B 435 558 2e-57 PDB
low complexity region 559 573 N/A INTRINSIC
transmembrane domain 579 598 N/A INTRINSIC
Pfam:Ion_trans 613 807 1.5e-44 PFAM
low complexity region 822 832 N/A INTRINSIC
low complexity region 852 864 N/A INTRINSIC
low complexity region 900 907 N/A INTRINSIC
transmembrane domain 951 973 N/A INTRINSIC
Pfam:Ion_trans 990 1220 3e-49 PFAM
Pfam:PKD_channel 1285 1537 1.4e-7 PFAM
Pfam:Ion_trans 1308 1530 4.4e-68 PFAM
Blast:EFh 1551 1579 5e-9 BLAST
Ca_chan_IQ 1665 1699 2.5e-19 SMART
low complexity region 1819 1829 N/A INTRINSIC
low complexity region 1999 2013 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000219018
AA Change: M1398R

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000219223
AA Change: M1387R

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000219833
AA Change: M1423R

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect possibly damaging
Transcript: ENSMUST00000220022
AA Change: M1481R

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha-1 subunit of a voltage-dependent calcium channel. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization. The alpha-1 subunit consists of 24 transmembrane segments and forms the pore through which ions pass into the cell. The calcium channel consists of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. There are multiple isoforms of each of these proteins, either encoded by different genes or the result of alternative splicing of transcripts. The protein encoded by this gene binds to and is inhibited by dihydropyridine. Alternative splicing results in many transcript variants encoding different proteins. Some of the predicted proteins may not produce functional ion channel subunits. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for mutations that inactivate the gene do not survive to term. Selective ablation in beta cells resulted in impaired insulin secretion and systemic glucose intolerance. Heterozygotes were hypoactive, showed increased anxiety, and poor motor coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 231 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 C T 7: 120,278,306 T1059I probably benign Het
Abcb11 C T 2: 69,261,566 A871T probably damaging Het
Acot7 T C 4: 152,260,912 L313P probably damaging Het
Adam20 T A 8: 40,796,558 H568Q probably benign Het
Adam26b T A 8: 43,521,677 D96V probably damaging Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Apbb1 A G 7: 105,574,227 V59A probably benign Het
Apc A G 18: 34,312,318 K722E probably damaging Het
Aspm A G 1: 139,473,574 I1111V probably benign Het
Aspscr1 A G 11: 120,678,516 T47A probably damaging Het
Atr G A 9: 95,897,581 V1331I probably benign Het
Baz1a G A 12: 54,898,788 R1261* probably null Het
C2cd2l C A 9: 44,319,743 R49L probably benign Het
C4bp C G 1: 130,642,988 V284L probably benign Het
Cacna1s T C 1: 136,118,716 F1761S probably benign Het
Camsap2 C T 1: 136,281,315 R802Q probably benign Het
Capn9 G A 8: 124,605,711 G430R possibly damaging Het
Ccdc177 A G 12: 80,759,239 V87A probably damaging Het
Ccdc178 T A 18: 22,097,723 I364F possibly damaging Het
Ccdc93 C T 1: 121,456,126 P192L probably benign Het
Ccdc93 T C 1: 121,461,939 V237A probably benign Het
Cd55 C T 1: 130,449,423 V333I probably benign Het
Cd55 C A 1: 130,459,633 A143S probably benign Het
Cdh19 C A 1: 110,893,384 E541D probably damaging Het
Cdh7 C G 1: 110,065,735 L307V possibly damaging Het
Cep120 A G 18: 53,719,214 probably null Het
Cep128 G T 12: 91,022,491 probably null Het
Cep131 T C 11: 120,083,906 I23V probably benign Het
Cfc1 A G 1: 34,537,234 D125G probably damaging Het
Cfh T C 1: 140,136,788 K374R probably benign Het
Cfh C T 1: 140,147,697 V268I possibly damaging Het
Cfhr2 A G 1: 139,813,442 M265T probably benign Het
Cfhr2 A C 1: 139,813,459 N259K probably benign Het
Chil1 C T 1: 134,188,529 A250V probably damaging Het
Clca1 C A 3: 145,007,778 M697I probably benign Het
Clec4a3 C T 6: 122,954,041 Q30* probably null Het
Cntnap3 T A 13: 64,740,592 R1232S probably benign Het
Cntnap5a C A 1: 116,455,004 L1001I probably benign Het
Cntnap5a T C 1: 116,455,101 L1033S probably benign Het
Cntnap5a C T 1: 116,455,143 T1047I probably benign Het
Col12a1 T A 9: 79,633,468 I2412F probably damaging Het
Crb1 T C 1: 139,234,779 M1214V probably benign Het
Crb1 A T 1: 139,237,622 H921Q probably benign Het
Crb1 G A 1: 139,241,138 P881S probably damaging Het
Crb1 C T 1: 139,242,995 G825R probably damaging Het
Crb1 C T 1: 139,243,417 R684H probably benign Het
Cxcl2 C T 5: 90,904,158 T41I probably damaging Het
Cxcr4 C T 1: 128,589,277 V216I probably benign Het
Cyb5r1 C T 1: 134,407,667 R147W probably damaging Het
Ddx59 T C 1: 136,417,053 V154A probably benign Het
Disp2 T C 2: 118,791,550 V921A probably damaging Het
Dnajc10 C G 2: 80,347,662 A671G probably benign Het
Dner T C 1: 84,370,784 I732V probably damaging Het
Dsel T C 1: 111,859,457 N1116S probably benign Het
Dsel G C 1: 111,859,994 T937S probably benign Het
Dstyk C T 1: 132,456,984 L739F probably damaging Het
Dysf T C 6: 84,112,235 probably null Het
Eefsec T A 6: 88,376,205 K161* probably null Het
Ehhadh G C 16: 21,762,253 A663G probably benign Het
En1 A G 1: 120,603,621 S197G unknown Het
Etnk2 A G 1: 133,363,923 S54G probably benign Het
Etnk2 C A 1: 133,365,587 D89E probably benign Het
Etnk2 G T 1: 133,365,765 G149W probably damaging Het
Etnk2 C T 1: 133,365,816 R166* probably null Het
Etnk2 G A 1: 133,365,817 R166Q probably benign Het
Etnk2 T A 1: 133,376,915 V292E probably benign Het
Exph5 T C 9: 53,375,588 V1323A possibly damaging Het
Eya2 G T 2: 165,687,663 G109W probably damaging Het
Fam72a T C 1: 131,530,668 I56T probably benign Het
Fam72a C T 1: 131,538,895 T139M probably benign Het
Fcamr A C 1: 130,804,627 N117T probably benign Het
Fcamr A G 1: 130,811,580 I206V probably benign Het
Fcamr G A 1: 130,812,629 G262S probably benign Het
Fcamr A G 1: 130,812,692 I283V probably benign Het
Fcamr T C 1: 130,812,738 V298A probably benign Het
Fcamr A G 1: 130,812,809 M322V probably benign Het
Fcamr C T 1: 130,812,816 P324L probably benign Het
Fcamr A G 1: 130,814,597 N574D probably benign Het
Fcmr A G 1: 130,875,974 T172A probably benign Het
Fcmr T C 1: 130,878,269 S321P probably benign Het
Focad T C 4: 88,397,891 M1560T probably benign Het
Gadd45gip1 T A 8: 84,832,292 M1K probably null Het
Gbgt1 T C 2: 28,505,052 V234A possibly damaging Het
Gin1 T A 1: 97,786,104 D376E probably damaging Het
Git1 A T 11: 77,498,982 I24F probably damaging Het
Gli2 C T 1: 118,868,087 A113T possibly damaging Het
Gli2 G T 1: 119,002,044 H44Q probably benign Het
Gm5152 T C 5: 10,245,204 I90V possibly damaging Het
Gnptab T C 10: 88,436,095 Y916H probably benign Het
Gpr25 G A 1: 136,260,710 P55L probably benign Het
Heg1 T G 16: 33,738,583 I1058S possibly damaging Het
Hivep3 A G 4: 120,095,174 Y229C probably benign Het
Idi1 T C 13: 8,890,411 F210L probably benign Het
Igfn1 G A 1: 135,959,928 P2466L probably damaging Het
Igfn1 G A 1: 135,968,199 A1543V probably benign Het
Igfn1 T C 1: 135,970,411 S806G probably benign Het
Igfn1 C T 1: 135,972,127 R482Q probably benign Het
Igfn1 C T 1: 135,979,915 A231T probably benign Het
Igfn1 G A 1: 135,982,475 R124W probably benign Het
Igfn1 T C 1: 135,998,625 E29G probably benign Het
Igfn1 T C 1: 135,998,683 I10V unknown Het
Ikbke C A 1: 131,265,937 A459S probably benign Het
Ikbke T C 1: 131,269,823 S447G probably benign Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Kat7 T G 11: 95,276,547 I455L possibly damaging Het
Kcnh5 G T 12: 75,114,229 P302T probably damaging Het
Kcnt2 G A 1: 140,354,547 S90N probably benign Het
Kif14 A G 1: 136,468,279 N108D probably benign Het
Kif14 A G 1: 136,468,975 K340E probably damaging Het
Kif14 G A 1: 136,478,365 A556T probably benign Het
Kif14 A G 1: 136,490,332 S868G probably benign Het
Kif14 C T 1: 136,503,431 L1189F probably benign Het
Kif14 T C 1: 136,515,961 F1291L probably benign Het
Kif14 T C 1: 136,525,783 V1433A probably benign Het
Krtap12-1 C T 10: 77,720,992 T123I possibly damaging Het
Ksr1 G A 11: 79,047,305 T49I probably damaging Het
Lad1 C T 1: 135,827,381 P132S possibly damaging Het
Lad1 C T 1: 135,828,023 R346C probably damaging Het
Lat2 T C 5: 134,606,369 H89R possibly damaging Het
Lax1 T C 1: 133,679,978 R342G probably benign Het
Lax1 T C 1: 133,680,569 N145D probably benign Het
Lax1 G A 1: 133,683,634 P67S probably damaging Het
Lgr6 C T 1: 134,987,088 V641I probably benign Het
Lgr6 A T 1: 134,988,009 S334T probably benign Het
Lgr6 G T 1: 134,990,635 H263N probably benign Het
Lgr6 C T 1: 135,003,476 S3N probably benign Het
Lmod1 C T 1: 135,364,073 T222I probably benign Het
Man2a2 T C 7: 80,362,438 E657G probably benign Het
Mfsd4a C T 1: 132,067,883 D4N possibly damaging Het
Mn1 G T 5: 111,420,014 A617S possibly damaging Het
Mov10 T C 3: 104,800,282 D592G probably damaging Het
Mroh3 G C 1: 136,192,144 Q440E possibly damaging Het
Mtmr12 A T 15: 12,245,019 T207S probably benign Het
Musk G A 4: 58,293,563 V51M probably damaging Het
Mybph C T 1: 134,197,480 R249C probably benign Het
Naglu C T 11: 101,076,403 A393V possibly damaging Het
Nav1 A T 1: 135,584,727 D198E possibly damaging Het
Ncan T A 8: 70,108,086 T744S probably benign Het
Nlrp4c T A 7: 6,073,222 V707E probably damaging Het
Nr5a2 C A 1: 136,952,125 R35L probably benign Het
Nrcam A T 12: 44,571,675 Q822L probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1232 T A 2: 89,325,566 I205F probably benign Het
Olfr1240 C T 2: 89,439,583 R232H probably benign Het
Olfr453 C A 6: 42,744,135 L33M possibly damaging Het
Optc A T 1: 133,903,796 probably null Het
Optc C G 1: 133,905,170 S64T probably benign Het
Pak1 T A 7: 97,904,695 V424E probably damaging Het
Pdcd6 G A 13: 74,304,041 T160I probably damaging Het
Phf21a C T 2: 92,360,299 T535M possibly damaging Het
Pigr C T 1: 130,844,522 A159V possibly damaging Het
Pik3c2b C T 1: 133,066,627 P110S probably benign Het
Pkdrej G A 15: 85,820,427 T436I probably benign Het
Plekha6 C G 1: 133,287,846 T792S probably benign Het
Ppil2 C G 16: 17,089,419 probably benign Het
Ppip5k2 A T 1: 97,728,957 H830Q probably damaging Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Ptpn7 A G 1: 135,134,475 Q53R probably benign Het
Ptprc T G 1: 138,099,676 N478T probably benign Het
Ptprc A G 1: 138,107,823 S405P probably benign Het
Ptprc C A 1: 138,107,824 E402D probably benign Het
Ptprc A G 1: 138,107,837 V400A probably benign Het
Ptprc T C 1: 138,112,254 K212E possibly damaging Het
Rab29 A G 1: 131,872,110 Q141R probably benign Het
Ren1 T A 1: 133,354,206 W22R probably damaging Het
Ren1 C T 1: 133,354,237 T32I probably benign Het
Ren1 A C 1: 133,356,457 K187Q probably benign Het
Ren1 A T 1: 133,359,079 E315D probably benign Het
Ren1 A T 1: 133,359,983 N352Y probably benign Het
Ren1 C G 1: 133,360,007 L360V probably benign Het
Rnpep C T 1: 135,263,096 A571T possibly damaging Het
Rnpep C G 1: 135,283,629 R127P probably benign Het
Sctr T C 1: 120,031,656 F110L probably benign Het
Sctr G T 1: 120,063,246 E453D probably benign Het
Sctr G A 1: 120,063,257 S440N possibly damaging Het
Sema4a A G 3: 88,436,838 L702P possibly damaging Het
Sept4 A T 11: 87,583,436 Q60L probably benign Het
Serpinb10 C T 1: 107,538,473 S63F probably damaging Het
Serpinb2 G A 1: 107,515,635 A55T probably damaging Het
Serpinb2 C A 1: 107,523,834 A239E probably benign Het
Serpinb2 C T 1: 107,523,890 H258Y probably benign Het
Serpinb2 C T 1: 107,523,894 T259I probably benign Het
Serpinb2 A C 1: 107,524,543 S284R probably benign Het
Serpinb8 A G 1: 107,597,527 S20G probably benign Het
Serpinb8 G A 1: 107,598,954 A75T probably benign Het
Serpinb8 A C 1: 107,607,004 L268F probably benign Het
Shank2 A T 7: 144,179,853 N482Y probably damaging Het
Shc3 A T 13: 51,482,916 V72E probably damaging Het
Slc26a9 C T 1: 131,763,870 A617V probably benign Het
Slc45a4 A G 15: 73,586,038 I562T probably damaging Het
Smc6 T G 12: 11,317,853 V1088G probably benign Het
Snx32 C A 19: 5,496,111 R341L probably benign Het
Specc1 C T 11: 62,118,818 Q467* probably null Het
Spock3 A T 8: 63,348,947 N323I probably damaging Het
Stac3 A G 10: 127,507,766 K259R probably benign Het
Steap3 T C 1: 120,227,750 N493S probably benign Het
Steap3 G A 1: 120,234,378 A350V probably benign Het
Stx3 A G 19: 11,785,523 I163T probably damaging Het
Suco A G 1: 161,827,655 probably null Het
Syngr4 A G 7: 45,888,722 F74S possibly damaging Het
Synpo2l G A 14: 20,665,819 P233S probably damaging Het
Tcf4 A T 18: 69,642,970 T163S probably damaging Het
Thsd7b C T 1: 129,628,891 T328I probably damaging Het
Thsd7b T A 1: 129,667,937 F498Y probably benign Het
Thsd7b G C 1: 129,678,183 A554P probably benign Het
Thsd7b A C 1: 130,116,631 Q1116P probably benign Het
Tlk1 T C 2: 70,721,077 Y634C probably damaging Het
Tnnt2 C T 1: 135,845,506 probably benign Het
Tox2 T C 2: 163,247,785 Y66H probably damaging Het
Trove2 C T 1: 143,760,014 V465I probably benign Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttn C T 2: 76,813,339 G11436R probably damaging Het
Ttyh1 G A 7: 4,129,349 M261I probably benign Het
Ubap2 A G 4: 41,206,849 V509A probably benign Het
Ube2t C T 1: 134,972,167 A149V probably benign Het
Ucp3 G C 7: 100,482,720 M259I probably benign Het
Unc80 A T 1: 66,527,892 N886Y probably damaging Het
Vmn1r197 T A 13: 22,328,371 L154Q possibly damaging Het
Vmn1r40 T A 6: 89,714,315 M38K probably benign Het
Vmn2r78 C A 7: 86,920,789 Q172K probably benign Het
Zc3h11a G A 1: 133,622,154 P695S probably benign Het
Zc3h11a C T 1: 133,624,621 V583I probably benign Het
Zfhx4 A T 3: 5,401,730 D2316V probably damaging Het
Zfp108 T C 7: 24,261,310 V442A probably damaging Het
Zfp260 A T 7: 30,104,806 T44S probably benign Het
Zfp873 C A 10: 82,060,707 T424N probably damaging Het
Zp3r A G 1: 130,596,814 L164P probably benign Het
Zp3r C A 1: 130,619,414 E8D possibly damaging Het
Zswim2 T A 2: 83,915,340 K585* probably null Het
Other mutations in Cacna1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Cacna1c APN 6 118676444 splice site probably benign
IGL00990:Cacna1c APN 6 118613295 missense probably damaging 1.00
IGL01352:Cacna1c APN 6 118656557 nonsense probably null
IGL01922:Cacna1c APN 6 118652668 missense probably damaging 0.99
IGL02008:Cacna1c APN 6 118715924 missense probably null 0.25
IGL02049:Cacna1c APN 6 118603919 missense probably benign 0.34
IGL02320:Cacna1c APN 6 118637792 missense probably damaging 1.00
IGL02375:Cacna1c APN 6 118675923 missense probably damaging 1.00
IGL02454:Cacna1c APN 6 118602180 missense probably damaging 1.00
IGL02544:Cacna1c APN 6 118751479 missense probably damaging 1.00
IGL02648:Cacna1c APN 6 118757496 missense probably damaging 1.00
IGL03191:Cacna1c APN 6 118741903 missense probably damaging 1.00
PIT4418001:Cacna1c UTSW 6 118654423 missense
PIT4469001:Cacna1c UTSW 6 118595972 missense unknown
R0041:Cacna1c UTSW 6 118594027 missense probably damaging 0.99
R0062:Cacna1c UTSW 6 118602237 missense probably damaging 1.00
R0062:Cacna1c UTSW 6 118602237 missense probably damaging 1.00
R0083:Cacna1c UTSW 6 118625523 missense probably damaging 1.00
R0131:Cacna1c UTSW 6 118625512 missense probably damaging 1.00
R0142:Cacna1c UTSW 6 118603882 missense probably damaging 1.00
R0193:Cacna1c UTSW 6 118602402 splice site probably benign
R0245:Cacna1c UTSW 6 118604454 missense probably benign 0.10
R0394:Cacna1c UTSW 6 118625497 missense probably damaging 1.00
R0555:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R0617:Cacna1c UTSW 6 118602213 missense probably damaging 1.00
R0652:Cacna1c UTSW 6 118602229 missense probably damaging 1.00
R0730:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R0812:Cacna1c UTSW 6 118630263 missense probably benign 0.07
R0828:Cacna1c UTSW 6 118757386 missense probably benign 0.24
R0837:Cacna1c UTSW 6 118630270 nonsense probably null
R0881:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R0882:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R0924:Cacna1c UTSW 6 118675896 missense probably damaging 1.00
R0930:Cacna1c UTSW 6 118675896 missense probably damaging 1.00
R1157:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1158:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1159:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1160:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1237:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1238:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1239:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1337:Cacna1c UTSW 6 118627455 missense probably damaging 1.00
R1433:Cacna1c UTSW 6 118652793 nonsense probably null
R1463:Cacna1c UTSW 6 118593994 missense probably benign 0.27
R1517:Cacna1c UTSW 6 118598759 missense probably benign 0.01
R1619:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1704:Cacna1c UTSW 6 118602146 missense probably benign 0.01
R1804:Cacna1c UTSW 6 118687046 missense probably damaging 1.00
R1889:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1891:Cacna1c UTSW 6 118776519 missense probably damaging 1.00
R1895:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1944:Cacna1c UTSW 6 118606266 missense probably damaging 1.00
R1961:Cacna1c UTSW 6 118630322 missense probably benign 0.05
R2043:Cacna1c UTSW 6 118596088 missense probably benign 0.01
R2045:Cacna1c UTSW 6 118656137 missense probably damaging 1.00
R2217:Cacna1c UTSW 6 118670407 missense probably damaging 1.00
R2237:Cacna1c UTSW 6 118652743 missense possibly damaging 0.94
R2509:Cacna1c UTSW 6 118734982 missense probably damaging 1.00
R3157:Cacna1c UTSW 6 118751524 missense probably benign 0.00
R3739:Cacna1c UTSW 6 118741952 missense probably benign
R3831:Cacna1c UTSW 6 118604463 missense probably benign 0.06
R4319:Cacna1c UTSW 6 118654369 missense probably damaging 1.00
R4477:Cacna1c UTSW 6 118630239 missense possibly damaging 0.48
R4571:Cacna1c UTSW 6 118630380 missense probably benign
R4671:Cacna1c UTSW 6 118652058 missense probably damaging 1.00
R4729:Cacna1c UTSW 6 118656175 missense probably damaging 1.00
R4741:Cacna1c UTSW 6 118613310 missense probably damaging 1.00
R4798:Cacna1c UTSW 6 118630302 nonsense probably null
R4803:Cacna1c UTSW 6 118751541 missense probably damaging 0.99
R4821:Cacna1c UTSW 6 118696425 missense probably damaging 1.00
R4888:Cacna1c UTSW 6 118751439 missense probably damaging 1.00
R4981:Cacna1c UTSW 6 118751471 missense probably benign 0.00
R5253:Cacna1c UTSW 6 118597969 missense probably benign 0.01
R5297:Cacna1c UTSW 6 118742361 missense probably damaging 1.00
R5345:Cacna1c UTSW 6 118656536 critical splice donor site probably null
R5364:Cacna1c UTSW 6 118656543 missense probably benign 0.35
R5439:Cacna1c UTSW 6 118654372 missense probably damaging 1.00
R5472:Cacna1c UTSW 6 118638446 missense possibly damaging 0.86
R5516:Cacna1c UTSW 6 119057218 missense probably damaging 1.00
R5590:Cacna1c UTSW 6 118687182 missense probably damaging 1.00
R5619:Cacna1c UTSW 6 118742361 missense probably damaging 1.00
R5684:Cacna1c UTSW 6 118687044 missense probably damaging 1.00
R5737:Cacna1c UTSW 6 118741932 missense probably damaging 1.00
R5768:Cacna1c UTSW 6 118697680 missense probably damaging 1.00
R5933:Cacna1c UTSW 6 118612580 missense probably damaging 1.00
R5965:Cacna1c UTSW 6 118602300 missense probably damaging 1.00
R6114:Cacna1c UTSW 6 118596140 missense probably benign 0.07
R6161:Cacna1c UTSW 6 119057302 missense probably damaging 1.00
R6267:Cacna1c UTSW 6 118598723 missense possibly damaging 0.52
R6267:Cacna1c UTSW 6 118652714 missense probably benign 0.09
R6296:Cacna1c UTSW 6 118598723 missense possibly damaging 0.52
R6296:Cacna1c UTSW 6 118652714 missense probably benign 0.09
R6307:Cacna1c UTSW 6 118613953 missense probably damaging 0.97
R6431:Cacna1c UTSW 6 118751373 missense probably damaging 1.00
R6467:Cacna1c UTSW 6 118652710 missense probably damaging 1.00
R7026:Cacna1c UTSW 6 118637771 missense probably damaging 1.00
R7049:Cacna1c UTSW 6 118601163 missense probably benign 0.35
R7072:Cacna1c UTSW 6 118596106 missense
R7192:Cacna1c UTSW 6 118656249 missense
R7243:Cacna1c UTSW 6 118637729 critical splice donor site probably null
R7250:Cacna1c UTSW 6 118598005 missense
R7250:Cacna1c UTSW 6 118696451 missense
R7264:Cacna1c UTSW 6 118602195 missense
R7312:Cacna1c UTSW 6 119057211 missense
R7392:Cacna1c UTSW 6 118741920 missense
R7401:Cacna1c UTSW 6 119052708 critical splice acceptor site probably null
R7449:Cacna1c UTSW 6 118602349 missense
R7451:Cacna1c UTSW 6 118594020 missense unknown
R7491:Cacna1c UTSW 6 118613343 missense
R7507:Cacna1c UTSW 6 119057239 missense
R7573:Cacna1c UTSW 6 118604445 missense
R7702:Cacna1c UTSW 6 118598766 missense
R7745:Cacna1c UTSW 6 119052626 missense
R7834:Cacna1c UTSW 6 118610581 missense
R7867:Cacna1c UTSW 6 118776446 missense
R7917:Cacna1c UTSW 6 118610581 missense
R7950:Cacna1c UTSW 6 118776446 missense
X0065:Cacna1c UTSW 6 118657376 missense probably damaging 1.00
Z1176:Cacna1c UTSW 6 118697737 missense
Z1177:Cacna1c UTSW 6 118757661 intron probably benign
Predicted Primers PCR Primer
(F):5'- AGGTCATTTTCCCCACAGAGGTCC -3'
(R):5'- AATGCCTGGCACATGGCTGTTC -3'

Sequencing Primer
(F):5'- CAGAGGTCCTTTAAATTTCAAAAGAG -3'
(R):5'- GCTAGTAGATAGCACAACTGTGTC -3'
Posted On2014-05-23