Incidental Mutation 'R1926:Zkscan1'
ID213431
Institutional Source Beutler Lab
Gene Symbol Zkscan1
Ensembl Gene ENSMUSG00000029729
Gene Namezinc finger with KRAB and SCAN domains 1
Synonyms9230118B16Rik, KOX18, 9130423L19Rik, 5930429A01Rik
MMRRC Submission 039944-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R1926 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location138085084-138107822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 138101363 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 450 (A450S)
Ref Sequence ENSEMBL: ENSMUSP00000106588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019660] [ENSMUST00000066617] [ENSMUST00000110962] [ENSMUST00000110963]
Predicted Effect probably benign
Transcript: ENSMUST00000019660
AA Change: A523S

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000019660
Gene: ENSMUSG00000029729
AA Change: A523S

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
SCAN 52 162 1.5e-75 SMART
KRAB 225 285 5.7e-8 SMART
low complexity region 300 314 N/A INTRINSIC
low complexity region 316 337 N/A INTRINSIC
ZnF_C2H2 375 397 1.3e-5 SMART
ZnF_C2H2 403 425 7.3e-6 SMART
ZnF_C2H2 431 453 5.6e-6 SMART
ZnF_C2H2 459 481 4e-7 SMART
ZnF_C2H2 487 509 3.8e-6 SMART
ZnF_C2H2 515 537 5.7e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066617
AA Change: A450S

PolyPhen 2 Score 0.333 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000068480
Gene: ENSMUSG00000029729
AA Change: A450S

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
SCAN 52 162 4.62e-73 SMART
low complexity region 227 241 N/A INTRINSIC
low complexity region 243 264 N/A INTRINSIC
ZnF_C2H2 302 324 2.95e-3 SMART
ZnF_C2H2 330 352 1.69e-3 SMART
ZnF_C2H2 358 380 1.28e-3 SMART
ZnF_C2H2 386 408 9.22e-5 SMART
ZnF_C2H2 414 436 9.08e-4 SMART
ZnF_C2H2 442 464 1.28e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110962
AA Change: A450S

PolyPhen 2 Score 0.333 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106587
Gene: ENSMUSG00000029729
AA Change: A450S

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
SCAN 52 162 4.62e-73 SMART
low complexity region 227 241 N/A INTRINSIC
low complexity region 243 264 N/A INTRINSIC
ZnF_C2H2 302 324 2.95e-3 SMART
ZnF_C2H2 330 352 1.69e-3 SMART
ZnF_C2H2 358 380 1.28e-3 SMART
ZnF_C2H2 386 408 9.22e-5 SMART
ZnF_C2H2 414 436 9.08e-4 SMART
ZnF_C2H2 442 464 1.28e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110963
AA Change: A450S

PolyPhen 2 Score 0.333 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106588
Gene: ENSMUSG00000029729
AA Change: A450S

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
SCAN 52 162 4.62e-73 SMART
low complexity region 227 241 N/A INTRINSIC
low complexity region 243 264 N/A INTRINSIC
ZnF_C2H2 302 324 2.95e-3 SMART
ZnF_C2H2 330 352 1.69e-3 SMART
ZnF_C2H2 358 380 1.28e-3 SMART
ZnF_C2H2 386 408 9.22e-5 SMART
ZnF_C2H2 414 436 9.08e-4 SMART
ZnF_C2H2 442 464 1.28e-3 SMART
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Kruppel C2H2-type zinc-finger family of proteins. This encoded protein may function as a transcription factor that regulates the expression of GABA type-A receptors in the brain. Transcripts from this gene have been shown to form stable and abundant circular RNAs. Elevated expression of this gene has been observed in gastric cancer and the encoded protein may stimulate migration and invasion of human gastric cancer cells. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,329,404 T1316I probably benign Het
Acsm3 C T 7: 119,777,136 T362M probably damaging Het
Ang6 A G 14: 44,002,238 V11A possibly damaging Het
Ankrd17 A G 5: 90,244,169 Y1880H probably damaging Het
BC049730 G A 7: 24,714,116 G186R probably damaging Het
Bmi1 A G 2: 18,682,273 I55V probably benign Het
Bnipl G A 3: 95,243,043 T297M probably damaging Het
Bpifa2 T C 2: 154,013,749 V198A probably benign Het
Brms1l G T 12: 55,863,161 V239F possibly damaging Het
Ccdc158 A G 5: 92,650,788 V351A probably benign Het
Ces1c A G 8: 93,127,604 F101S possibly damaging Het
Cpb2 T C 14: 75,242,397 Y15H probably benign Het
Dglucy A T 12: 100,867,155 N535I possibly damaging Het
Dopey1 C A 9: 86,523,019 H1763Q probably damaging Het
Dpy19l1 C T 9: 24,473,824 M236I probably benign Het
Efna2 T C 10: 80,186,876 Y85H probably damaging Het
Eipr1 A T 12: 28,864,837 probably null Het
Eln A T 5: 134,706,567 Y787* probably null Het
Erbb2 G C 11: 98,425,164 E364D probably benign Het
F5 A G 1: 164,179,508 T294A probably damaging Het
Fam47e A G 5: 92,585,385 T194A possibly damaging Het
Galk1 T C 11: 116,010,247 D202G probably damaging Het
Glb1l2 T C 9: 26,771,066 D163G probably damaging Het
Gmip A G 8: 69,815,520 E408G probably benign Het
Gp1ba A T 11: 70,640,889 probably benign Het
Grm3 A T 5: 9,504,881 C804S probably damaging Het
Gzmd A G 14: 56,130,280 C179R probably damaging Het
Hadhb T A 5: 30,180,937 L415Q possibly damaging Het
Ift80 T C 3: 68,916,165 Y588C probably damaging Het
Jazf1 T C 6: 53,068,531 T13A probably benign Het
Kat8 T A 7: 127,915,295 Y67* probably null Het
Kcnab1 G A 3: 65,376,512 E384K possibly damaging Het
Lhx3 A T 2: 26,202,188 Y230* probably null Het
Lmx1b T A 2: 33,564,662 M365L probably damaging Het
Ly6k G T 15: 74,797,202 P76Q probably benign Het
Map1b A T 13: 99,430,692 H1840Q unknown Het
Map3k2 A G 18: 32,203,110 I117V probably damaging Het
Med13 C A 11: 86,289,073 A1350S possibly damaging Het
Midn T C 10: 80,151,661 S109P probably damaging Het
Msh6 A G 17: 87,986,225 T803A probably benign Het
Nckap1 T C 2: 80,506,838 Y1018C probably damaging Het
Ndufc1 A T 3: 51,407,395 N63K probably benign Het
Neb A T 2: 52,279,635 S1811R probably damaging Het
Notch1 T C 2: 26,481,657 D260G probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Oas1g T C 5: 120,879,142 K283R probably benign Het
Obscn T C 11: 59,063,474 T4037A possibly damaging Het
Olfr1414 A G 1: 92,511,608 L140P probably damaging Het
Olfr449 T G 6: 42,838,313 L144R probably damaging Het
Otop2 A T 11: 115,326,955 T206S probably benign Het
Pamr1 A G 2: 102,640,997 probably null Het
Pkp1 G A 1: 135,877,673 T675I probably benign Het
Plxna2 G A 1: 194,762,450 V717I probably benign Het
Ptgs2 T C 1: 150,100,228 L2P possibly damaging Het
Rarg A G 15: 102,239,545 F277S probably damaging Het
Rassf5 A T 1: 131,212,339 I161N probably damaging Het
Rxfp4 A G 3: 88,652,352 V264A probably benign Het
Secisbp2l T A 2: 125,740,677 Q953L probably damaging Het
Serpinb9c T C 13: 33,150,235 I275V probably benign Het
Slc2a12 T C 10: 22,665,242 V332A probably damaging Het
Slc7a1 T C 5: 148,348,303 S127G probably damaging Het
Slc7a4 A T 16: 17,575,704 V77E probably damaging Het
Sp8 G A 12: 118,849,229 S273N possibly damaging Het
Spag6l G T 16: 16,763,057 N475K probably benign Het
St18 A G 1: 6,802,689 H216R probably benign Het
Tcirg1 C T 19: 3,902,843 probably benign Het
Tmeff1 A G 4: 48,658,788 Y87C probably damaging Het
Tmem94 T C 11: 115,792,900 V713A possibly damaging Het
Tnrc6b G T 15: 80,881,162 R955L probably damaging Het
Trip12 A G 1: 84,749,291 V1153A probably damaging Het
Tshz3 T C 7: 36,769,375 L263S probably damaging Het
Tubb6 G A 18: 67,401,321 probably null Het
Ube3a T C 7: 59,276,379 W302R probably damaging Het
Vcpkmt A T 12: 69,582,745 V81E probably damaging Het
Vmn1r175 T A 7: 23,809,041 I54F possibly damaging Het
Vwa8 T A 14: 79,020,635 N741K probably benign Het
Yeats2 A G 16: 20,214,426 T1034A probably benign Het
Zc3h6 G A 2: 128,997,795 R176Q probably damaging Het
Zfp207 T A 11: 80,395,427 Y424* probably null Het
Zfp729a A G 13: 67,619,557 V851A probably benign Het
Zkscan3 A G 13: 21,396,446 V24A possibly damaging Het
Other mutations in Zkscan1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03172:Zkscan1 APN 5 138094002 missense probably benign 0.00
R0078:Zkscan1 UTSW 5 138093101 missense probably damaging 1.00
R0206:Zkscan1 UTSW 5 138101186 missense probably damaging 1.00
R0206:Zkscan1 UTSW 5 138101186 missense probably damaging 1.00
R0324:Zkscan1 UTSW 5 138097523 missense probably damaging 1.00
R0503:Zkscan1 UTSW 5 138093326 missense probably damaging 0.99
R0940:Zkscan1 UTSW 5 138093170 missense probably damaging 1.00
R1879:Zkscan1 UTSW 5 138097148 missense probably damaging 1.00
R3749:Zkscan1 UTSW 5 138101441 missense probably damaging 0.99
R5045:Zkscan1 UTSW 5 138100920 missense probably damaging 1.00
R5391:Zkscan1 UTSW 5 138097101 missense probably benign
R6339:Zkscan1 UTSW 5 138093305 missense probably damaging 1.00
R6936:Zkscan1 UTSW 5 138093305 missense probably damaging 1.00
R7178:Zkscan1 UTSW 5 138100930 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTAATAACACCCCAGAGGAGGC -3'
(R):5'- CCTCGATGGGTACATAGGTAATTC -3'

Sequencing Primer
(F):5'- CCCTATGAATGTAACGAGTGTGGC -3'
(R):5'- TGGGTACATAGGTAATTCCAGAAAC -3'
Posted On2014-07-14