Incidental Mutation 'R0206:Zkscan1'
ID35454
Institutional Source Beutler Lab
Gene Symbol Zkscan1
Ensembl Gene ENSMUSG00000029729
Gene Namezinc finger with KRAB and SCAN domains 1
Synonyms9230118B16Rik, KOX18, 9130423L19Rik, 5930429A01Rik
MMRRC Submission 038459-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R0206 (G1)
Quality Score118
Status Validated
Chromosome5
Chromosomal Location138085084-138107822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 138101186 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 391 (C391S)
Ref Sequence ENSEMBL: ENSMUSP00000106588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019660] [ENSMUST00000066617] [ENSMUST00000110962] [ENSMUST00000110963]
Predicted Effect probably damaging
Transcript: ENSMUST00000019660
AA Change: C464S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000019660
Gene: ENSMUSG00000029729
AA Change: C464S

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
SCAN 52 162 1.5e-75 SMART
KRAB 225 285 5.7e-8 SMART
low complexity region 300 314 N/A INTRINSIC
low complexity region 316 337 N/A INTRINSIC
ZnF_C2H2 375 397 1.3e-5 SMART
ZnF_C2H2 403 425 7.3e-6 SMART
ZnF_C2H2 431 453 5.6e-6 SMART
ZnF_C2H2 459 481 4e-7 SMART
ZnF_C2H2 487 509 3.8e-6 SMART
ZnF_C2H2 515 537 5.7e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000066617
AA Change: C391S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068480
Gene: ENSMUSG00000029729
AA Change: C391S

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
SCAN 52 162 4.62e-73 SMART
low complexity region 227 241 N/A INTRINSIC
low complexity region 243 264 N/A INTRINSIC
ZnF_C2H2 302 324 2.95e-3 SMART
ZnF_C2H2 330 352 1.69e-3 SMART
ZnF_C2H2 358 380 1.28e-3 SMART
ZnF_C2H2 386 408 9.22e-5 SMART
ZnF_C2H2 414 436 9.08e-4 SMART
ZnF_C2H2 442 464 1.28e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110962
AA Change: C391S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106587
Gene: ENSMUSG00000029729
AA Change: C391S

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
SCAN 52 162 4.62e-73 SMART
low complexity region 227 241 N/A INTRINSIC
low complexity region 243 264 N/A INTRINSIC
ZnF_C2H2 302 324 2.95e-3 SMART
ZnF_C2H2 330 352 1.69e-3 SMART
ZnF_C2H2 358 380 1.28e-3 SMART
ZnF_C2H2 386 408 9.22e-5 SMART
ZnF_C2H2 414 436 9.08e-4 SMART
ZnF_C2H2 442 464 1.28e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110963
AA Change: C391S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106588
Gene: ENSMUSG00000029729
AA Change: C391S

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
SCAN 52 162 4.62e-73 SMART
low complexity region 227 241 N/A INTRINSIC
low complexity region 243 264 N/A INTRINSIC
ZnF_C2H2 302 324 2.95e-3 SMART
ZnF_C2H2 330 352 1.69e-3 SMART
ZnF_C2H2 358 380 1.28e-3 SMART
ZnF_C2H2 386 408 9.22e-5 SMART
ZnF_C2H2 414 436 9.08e-4 SMART
ZnF_C2H2 442 464 1.28e-3 SMART
Meta Mutation Damage Score 0.546 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.1%
  • 10x: 94.6%
  • 20x: 89.0%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Kruppel C2H2-type zinc-finger family of proteins. This encoded protein may function as a transcription factor that regulates the expression of GABA type-A receptors in the brain. Transcripts from this gene have been shown to form stable and abundant circular RNAs. Elevated expression of this gene has been observed in gastric cancer and the encoded protein may stimulate migration and invasion of human gastric cancer cells. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A G 9: 103,282,662 C5R probably damaging Het
4930430F08Rik T A 10: 100,586,194 K69* probably null Het
A530064D06Rik G A 17: 48,163,318 T165I probably benign Het
A830010M20Rik A G 5: 107,505,040 T304A probably benign Het
Acsl5 A G 19: 55,280,569 K221E probably benign Het
Adam26a A C 8: 43,570,418 F12V possibly damaging Het
Adgrb2 T C 4: 129,992,559 L164P probably damaging Het
Aldh1l1 T C 6: 90,569,866 F384L possibly damaging Het
Arhgef5 A G 6: 43,273,341 E342G probably damaging Het
C130079G13Rik C T 3: 59,932,689 R61C probably damaging Het
Cacna1b A G 2: 24,607,480 S2140P probably damaging Het
Camsap2 G C 1: 136,281,000 P918R probably damaging Het
Cdca3 C T 6: 124,832,551 probably benign Het
Cenpj G T 14: 56,563,970 A182E probably benign Het
Cit A T 5: 115,994,030 N1782Y possibly damaging Het
Cmya5 A G 13: 93,095,557 S1008P probably damaging Het
Csgalnact2 T G 6: 118,114,386 Q197P probably benign Het
D630045J12Rik A G 6: 38,139,450 M1745T probably damaging Het
Ddt A G 10: 75,772,885 M1T probably null Het
Dnah11 A C 12: 118,043,774 N2156K probably damaging Het
Dock3 G T 9: 106,996,996 Y425* probably null Het
Eng A T 2: 32,678,993 T511S probably benign Het
Fam192a A G 8: 94,588,011 F73S probably damaging Het
Gabra6 C T 11: 42,317,079 W188* probably null Het
Gnptab A T 10: 88,439,510 H1111L probably damaging Het
H2-M10.4 A G 17: 36,460,483 W268R probably damaging Het
Hrct1 C A 4: 43,727,384 T8K possibly damaging Het
Il2ra T C 2: 11,682,017 probably benign Het
Inpp5k T C 11: 75,631,143 I15T probably benign Het
Ipcef1 A G 10: 6,920,062 S113P probably damaging Het
Kctd8 A T 5: 69,341,165 V46E probably damaging Het
Klk1b9 T A 7: 43,979,430 N119K possibly damaging Het
Krtap9-3 C A 11: 99,597,837 C73F probably damaging Het
Loxhd1 T A 18: 77,404,866 F1334L possibly damaging Het
Me3 A T 7: 89,849,660 T483S probably benign Het
Med1 A G 11: 98,155,689 probably benign Het
Med13 A G 11: 86,300,856 probably benign Het
Mvk C T 5: 114,458,974 T334M probably damaging Het
Mxra8 T A 4: 155,842,596 I329N probably damaging Het
Mybphl T C 3: 108,375,415 V207A probably damaging Het
Myom1 T C 17: 71,037,297 S266P probably damaging Het
Nr2f2 G C 7: 70,360,175 P52R probably damaging Het
Olfr1032 T C 2: 86,008,292 I172T probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr308 T C 7: 86,321,646 Y102C probably benign Het
Olfr412 A T 11: 74,365,142 I158F probably benign Het
Olfr690 A T 7: 105,329,883 M103K possibly damaging Het
Olfr693 A G 7: 106,677,574 V304A probably benign Het
Pcdhb18 T C 18: 37,490,187 I190T possibly damaging Het
Pgbd1 A C 13: 21,434,481 L2R probably damaging Het
Pkp4 A G 2: 59,266,436 I61V probably damaging Het
Pold4 T G 19: 4,232,539 Y58* probably null Het
Pomgnt1 T C 4: 116,158,560 probably null Het
Prex2 T A 1: 11,285,144 D1556E probably damaging Het
Psmd1 T C 1: 86,133,741 V891A possibly damaging Het
Rmdn2 T A 17: 79,650,287 probably benign Het
Ryr2 A G 13: 11,676,251 probably benign Het
Scgb2b27 C A 7: 34,012,137 E96* probably null Het
Sec16b G T 1: 157,552,935 G359* probably null Het
Slc1a3 A G 15: 8,708,556 probably benign Het
Slc28a1 A T 7: 81,117,706 probably benign Het
Slc35d1 T C 4: 103,208,154 T177A probably damaging Het
Snx33 G A 9: 56,926,224 S187L probably damaging Het
Spg11 C T 2: 122,055,696 probably null Het
Spint1 T C 2: 119,248,345 probably benign Het
Spta1 A G 1: 174,192,960 H545R probably damaging Het
Tinag A G 9: 76,999,852 I367T probably damaging Het
Tln1 C T 4: 43,549,151 V644M probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Ube4b T C 4: 149,398,637 H58R probably benign Het
Ush2a A C 1: 188,531,761 I1612L probably damaging Het
Usp28 A G 9: 49,028,269 Y275C probably damaging Het
Vmn2r6 T C 3: 64,539,912 T578A probably benign Het
Vps13c A G 9: 67,939,162 probably benign Het
Vwf T C 6: 125,637,456 F1100S probably damaging Het
Zfp318 G T 17: 46,399,019 R556L probably benign Het
Other mutations in Zkscan1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03172:Zkscan1 APN 5 138094002 missense probably benign 0.00
R0078:Zkscan1 UTSW 5 138093101 missense probably damaging 1.00
R0206:Zkscan1 UTSW 5 138101186 missense probably damaging 1.00
R0324:Zkscan1 UTSW 5 138097523 missense probably damaging 1.00
R0503:Zkscan1 UTSW 5 138093326 missense probably damaging 0.99
R0940:Zkscan1 UTSW 5 138093170 missense probably damaging 1.00
R1879:Zkscan1 UTSW 5 138097148 missense probably damaging 1.00
R1926:Zkscan1 UTSW 5 138101363 missense probably benign 0.33
R3749:Zkscan1 UTSW 5 138101441 missense probably damaging 0.99
R5045:Zkscan1 UTSW 5 138100920 missense probably damaging 1.00
R5391:Zkscan1 UTSW 5 138097101 missense probably benign
R6339:Zkscan1 UTSW 5 138093305 missense probably damaging 1.00
R6936:Zkscan1 UTSW 5 138093305 missense probably damaging 1.00
R7178:Zkscan1 UTSW 5 138100930 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTAATAACACCCCAGAGGAGGCTCCG -3'
(R):5'- TTCAGGAATGCCCCAAAGGCATCCAG -3'

Sequencing Primer
(F):5'- ccgccataaaatcatccacac -3'
(R):5'- CAGAGAGGCTGGGCTGTATTC -3'
Posted On2013-05-09