Mutagenetix > Incidental Mutations

Incidental Mutation 'R2226:Nxph3'

239738

Institutional Source

Beutler Lab

Gene Symbol

Nxph3

Ensembl Gene

ENSMUSG00000046719

Gene Name

neurexophilin 3

Synonyms

MMRRC Submission

040227-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.104) question?

Stock #

R2226 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

95509845-95514570 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 95514164 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 17 (Y17C)

Ref Sequence

ENSEMBL: ENSMUSP00000058254 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058866]

Predicted Effect

probably benign
Transcript: ENSMUST00000058866
AA Change: Y17C

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000058254
Gene: ENSMUSG00000046719
AA Change: Y17C

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Neurexophilin	57	252	7.4e-100	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele display alterations in sensory information processing and motor coordination, as shown by increased startle response, reduced prepulse inhibition, and impaired rotarod performance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl3	A	T	4: 144,463,725	V2E	possibly damaging	Het
Aen	C	A	7: 78,902,451	T15K	probably benign	Het
Aggf1	A	G	13: 95,370,846	S144P	probably damaging	Het
Ar	T	A	X: 98,151,331	M517K	probably benign	Het
Ascc3	A	G	10: 50,754,052	T1746A	probably benign	Het
Atg9b	A	G	5: 24,386,395	V735A	possibly damaging	Het
Atp1b3	A	G	9: 96,343,276	F113S	probably damaging	Het
BC005561	T	A	5: 104,519,420	Y603N	probably damaging	Het
Cacna1h	T	C	17: 25,385,943	N1132S	probably benign	Het
Ccdc150	A	G	1: 54,364,925	I943V	probably null	Het
Cntnap4	A	G	8: 112,815,488	D751G	probably damaging	Het
Dgkk	T	A	X: 6,875,248	D102E	probably damaging	Het
Efhb	A	T	17: 53,462,429		probably null	Het
Elfn2	A	G	15: 78,674,243	W35R	probably damaging	Het
Emcn	T	C	3: 137,404,017	I140T	possibly damaging	Het
Epha2	G	A	4: 141,321,237	R569H	probably damaging	Het
Gabrg2	A	T	11: 41,971,908	F116L	probably damaging	Het
Gm11555	T	G	11: 99,649,759	R141S	unknown	Het
Gm4985	T	A	X: 23,958,934	M1L	probably null	Het
Gm5415	A	T	1: 32,545,853	H325Q	probably damaging	Het
Hectd3	T	C	4: 116,995,689	I96T	possibly damaging	Het
Hnrnpul2	T	A	19: 8,824,985	N405K	probably damaging	Het
Iigp1	A	T	18: 60,389,888	K26I	possibly damaging	Het
Kirrel2	T	C	7: 30,454,154	K260R	probably damaging	Het
Kpna1	G	A	16: 36,031,221	A392T	probably damaging	Het
Krt19	T	C	11: 100,141,575	E260G	probably damaging	Het
March7	A	G	2: 60,229,846	R106G	probably benign	Het
Mthfd2l	G	T	5: 90,948,834	E105*	probably null	Het
Mtus1	C	T	8: 41,082,775	V635M	probably damaging	Het
Ndufaf5	T	C	2: 140,188,860	V222A	probably benign	Het
Nkpd1	A	T	7: 19,519,820	Y37F	probably benign	Het
Nsun7	T	A	5: 66,261,219	Y97*	probably null	Het
Olfr1110	A	C	2: 87,136,246	V25G	possibly damaging	Het
Olfr167	T	C	16: 19,515,246	H130R	probably benign	Het
Olfr586	A	G	7: 103,121,908	M292T	probably benign	Het
Olfr728	A	G	14: 50,140,619	S7P	probably damaging	Het
Olfr832	A	T	9: 18,944,881	I78F	probably damaging	Het
P2rx2	A	G	5: 110,342,879	F26S	probably damaging	Het
Pank1	A	T	19: 34,827,363	L131Q	probably damaging	Het
Pcx	T	C	19: 4,617,998	I516T	possibly damaging	Het
Pkhd1l1	T	C	15: 44,512,792	I950T	possibly damaging	Het
Ppwd1	A	G	13: 104,217,245	L335P	probably damaging	Het
Ptch1	A	G	13: 63,513,671	S1218P	probably damaging	Het
Ptpn4	C	T	1: 119,682,785	R664Q	probably damaging	Het
Sfxn1	A	G	13: 54,085,517	T20A	possibly damaging	Het
Sgsm3	A	G	15: 81,003,868	E53G	probably damaging	Het
Slc22a19	C	T	19: 7,683,850	V320M	possibly damaging	Het
Slc25a33	A	T	4: 149,753,849	I122N	probably benign	Het
Spata31d1a	T	A	13: 59,703,715	I200L	probably benign	Het
Spin2g	A	T	X: 34,237,275	I171N	possibly damaging	Het
Srsf6	G	A	2: 162,931,699	S10N	probably damaging	Het
Ttc12	A	G	9: 49,441,835		probably null	Het
Vmn2r100	A	G	17: 19,522,372	K336R	probably benign	Het
Vmn2r108	A	T	17: 20,481,033	Y68*	probably null	Het
Zfp738	A	G	13: 67,670,312	F520S	probably damaging	Het

Other mutations in Nxph3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01490:Nxph3	APN	11	95511093	missense	possibly damaging	0.93
IGL02411:Nxph3	APN	11	95510830	makesense	probably null
IGL02666:Nxph3	APN	11	95511008	missense	possibly damaging	0.93
R0281:Nxph3	UTSW	11	95511256	missense	possibly damaging	0.95
R0827:Nxph3	UTSW	11	95511426	missense	probably benign	0.01
R4829:Nxph3	UTSW	11	95511495	missense	probably benign	0.17
R6470:Nxph3	UTSW	11	95511093	missense	possibly damaging	0.93
R6991:Nxph3	UTSW	11	95511418	missense	probably damaging	0.97
R7113:Nxph3	UTSW	11	95511066	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- CGGGTAATCCTTGGCTACTCAG -3'
(R):5'- TGGTCTGGGGAATTAGCACC -3'

Sequencing Primer
(F):5'- GGGGCCTTTTCCCTAGTGTCAC -3'
(R):5'- CAGCACATCTGGGTGAGAGC -3'

Posted On

2014-10-15