Incidental Mutation 'R2264:Pea15a'
ID243968
Institutional Source Beutler Lab
Gene Symbol Pea15a
Ensembl Gene ENSMUSG00000013698
Gene Namephosphoprotein enriched in astrocytes 15A
SynonymsPea15, Mat1, PEA-15, Pkcs15
MMRRC Submission 040264-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.251) question?
Stock #R2264 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location172196728-172206804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 172199137 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 79 (R79H)
Ref Sequence ENSEMBL: ENSMUSP00000106878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013842] [ENSMUST00000074144] [ENSMUST00000111247] [ENSMUST00000155109] [ENSMUST00000191689] [ENSMUST00000192704] [ENSMUST00000193638]
Predicted Effect probably benign
Transcript: ENSMUST00000013842
AA Change: R101H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000013842
Gene: ENSMUSG00000013698
AA Change: R101H

DomainStartEndE-ValueType
DED 2 81 2.25e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000074144
SMART Domains Protein: ENSMUSP00000073778
Gene: ENSMUSG00000026554

DomainStartEndE-ValueType
WD40 176 215 3.42e-7 SMART
WD40 218 260 2e-1 SMART
WD40 264 306 1.71e1 SMART
WD40 314 354 5.73e0 SMART
WD40 369 409 1.43e0 SMART
WD40 415 457 2.58e-1 SMART
WD40 460 500 5.91e-2 SMART
low complexity region 544 556 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111247
AA Change: R79H

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000106878
Gene: ENSMUSG00000013698
AA Change: R79H

DomainStartEndE-ValueType
DED 2 59 9.4e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125361
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152432
Predicted Effect probably benign
Transcript: ENSMUST00000155109
SMART Domains Protein: ENSMUSP00000117735
Gene: ENSMUSG00000013698

DomainStartEndE-ValueType
DED 2 81 2.25e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191689
SMART Domains Protein: ENSMUSP00000141731
Gene: ENSMUSG00000026554

DomainStartEndE-ValueType
WD40 176 215 3.42e-7 SMART
WD40 218 260 2e-1 SMART
WD40 264 306 1.71e1 SMART
WD40 314 354 5.73e0 SMART
WD40 369 409 1.43e0 SMART
WD40 415 457 2.58e-1 SMART
WD40 460 500 5.91e-2 SMART
low complexity region 544 556 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191891
Predicted Effect probably benign
Transcript: ENSMUST00000192704
SMART Domains Protein: ENSMUSP00000141732
Gene: ENSMUSG00000026554

DomainStartEndE-ValueType
WD40 176 215 3.42e-7 SMART
WD40 218 260 2e-1 SMART
WD40 264 306 1.71e1 SMART
WD40 314 354 5.73e0 SMART
WD40 369 409 1.43e0 SMART
WD40 415 457 2.58e-1 SMART
WD40 460 500 5.91e-2 SMART
low complexity region 544 556 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193638
SMART Domains Protein: ENSMUSP00000141836
Gene: ENSMUSG00000026554

DomainStartEndE-ValueType
WD40 176 215 3.42e-7 SMART
WD40 218 260 2e-1 SMART
WD40 264 306 1.71e1 SMART
WD40 314 354 5.73e0 SMART
Meta Mutation Damage Score 0.1301 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 94% (65/69)
MGI Phenotype FUNCTION: This gene encodes an adaptor protein that functions as a negative regulator of apoptosis induced by tumor necrosis factor-alpha, tumor necrosis factor-related apoptosis-inducing ligand, and Fas, through its interaction with fas-associated protein with death domain and caspase-8. It also regulates proliferation signaling by relocating the extracellular signal-regulated protein kinases 1 and 2 to the cytosol. The protein encoded by this gene contains an N-terminal death effector domain and a long, flexible C-terminal tail. In humans, the encoded protein is an endogenous substrate for protein kinase C. This protein is overexpressed in type 2 diabetes mellitus, where it may contribute to insulin resistance in glucose uptake. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice exhibit reduced body weight. Although Tnfa-induced apoptosis was increased in astrocytes in vitro, glial cell and brain morphology is normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,010,274 S1042P probably damaging Het
Armc1 C T 3: 19,134,869 V211I probably damaging Het
Asna1 G A 8: 85,025,258 probably benign Het
B4galnt3 T C 6: 120,203,810 *986W probably null Het
BC024139 T A 15: 76,125,917 D105V probably damaging Het
BC049715 C T 6: 136,840,436 Q225* probably null Het
Cadps2 T C 6: 23,323,340 H1043R probably benign Het
Casc1 A G 6: 145,208,429 probably benign Het
Ccdc42 T C 11: 68,587,651 V33A probably benign Het
Cldn1 A G 16: 26,359,199 Y159H probably damaging Het
Cog6 A T 3: 52,992,911 C476* probably null Het
Col14a1 T G 15: 55,466,690 probably null Het
Crisp1 C T 17: 40,313,074 M1I probably null Het
Dip2b T A 15: 100,203,216 S1297T probably benign Het
Dlgap4 A G 2: 156,701,463 E262G probably benign Het
Dpp4 A C 2: 62,378,239 V187G possibly damaging Het
F5 A G 1: 164,194,402 D1482G probably benign Het
Fads6 T A 11: 115,286,235 T132S probably damaging Het
Fat4 A G 3: 38,890,422 I1155V probably benign Het
Fermt1 C T 2: 132,915,190 probably null Het
Fstl1 C T 16: 37,777,291 probably benign Het
Gm5089 T C 14: 122,436,102 Y69C unknown Het
Gm9871 T C 6: 101,796,240 noncoding transcript Het
Gpr89 A G 3: 96,872,515 S375P probably damaging Het
Gtf2h4 A G 17: 35,668,664 probably benign Het
Gtsf1 T A 15: 103,419,964 N148I possibly damaging Het
Hexa T C 9: 59,555,377 S129P probably damaging Het
Iigp1 A T 18: 60,390,666 E285D probably benign Het
Il23r T A 6: 67,426,667 probably null Het
Iqch T C 9: 63,512,299 K463R probably benign Het
Kcnd1 A G X: 7,824,084 probably null Het
Kif26b A T 1: 178,928,842 probably null Het
Loxl1 A G 9: 58,297,678 V418A probably damaging Het
Lrp2 T C 2: 69,482,366 D2526G possibly damaging Het
Map4 G T 9: 110,081,457 G851C probably damaging Het
Mtmr11 A T 3: 96,169,097 E456V possibly damaging Het
Muc13 G A 16: 33,808,039 probably null Het
Myo18a C A 11: 77,819,972 probably benign Het
Nphp4 T A 4: 152,503,008 probably benign Het
Nrg3 T C 14: 38,381,702 E445G probably damaging Het
Ntrk1 A G 3: 87,779,634 probably null Het
Olfr906 G T 9: 38,488,055 V9L possibly damaging Het
Parp6 T C 9: 59,624,005 S57P probably damaging Het
Pcdhb12 A G 18: 37,436,805 N335D probably damaging Het
Pdzph1 T C 17: 58,888,167 probably null Het
Pik3ca A C 3: 32,437,927 I225L possibly damaging Het
Pim3 T A 15: 88,864,590 I270N probably damaging Het
Pkd1l1 T A 11: 8,879,112 R1043S probably damaging Het
Plekhg6 A G 6: 125,377,468 S70P probably benign Het
Ptpn13 T A 5: 103,489,661 D138E possibly damaging Het
Rap1gap T C 4: 137,727,723 L354P probably benign Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Sf3a1 T A 11: 4,177,443 S590T probably benign Het
Slc14a2 T C 18: 78,163,089 probably benign Het
Slfn3 T G 11: 83,212,972 I223S probably benign Het
Smarca1 C T X: 47,875,283 V331I probably benign Het
Soat1 A G 1: 156,437,697 probably benign Het
Tinagl1 A G 4: 130,167,433 V308A probably benign Het
Tomm22 T A 15: 79,671,287 Y78N probably damaging Het
Ttll1 T C 15: 83,496,408 Y252C probably damaging Het
Ttn C T 2: 76,793,130 V15368I probably benign Het
Ubr4 T C 4: 139,420,373 probably benign Het
Wbp2 T C 11: 116,079,598 probably null Het
Xkr7 A T 2: 153,054,257 I344F probably damaging Het
Zfp947 A T 17: 22,145,938 C252S probably benign Het
Other mutations in Pea15a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2002:Pea15a UTSW 1 172198685 missense probably benign 0.01
R4831:Pea15a UTSW 1 172199173 missense probably damaging 1.00
R5475:Pea15a UTSW 1 172199242 unclassified probably null
R6074:Pea15a UTSW 1 172199185 missense possibly damaging 0.78
R7606:Pea15a UTSW 1 172200583 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGGCAGGCCCATTAAGCATC -3'
(R):5'- ACCTCTATAGCCTAGCTCTGAC -3'

Sequencing Primer
(F):5'- CAAGCAGATTTCTGAGTTCGAGGC -3'
(R):5'- TATAGCCTAGCTCTGACACAAGCTG -3'
Posted On2014-10-16