Incidental Mutation 'R2447:Mta3'
ID248910
Institutional Source Beutler Lab
Gene Symbol Mta3
Ensembl Gene ENSMUSG00000055817
Gene Namemetastasis associated 3
Synonyms1110002J22Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.649) question?
Stock #R2447 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location83706163-83821516 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 83804544 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 567 (T567I)
Ref Sequence ENSEMBL: ENSMUSP00000107971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067826] [ENSMUST00000112352] [ENSMUST00000176816] [ENSMUST00000177069]
Predicted Effect probably benign
Transcript: ENSMUST00000067826
AA Change: T566I

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000068931
Gene: ENSMUSG00000055817
AA Change: T566I

DomainStartEndE-ValueType
BAH 4 147 2.62e-30 SMART
ELM2 150 203 3.49e-16 SMART
SANT 266 315 7.94e-8 SMART
ZnF_GATA 371 425 8.33e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112352
AA Change: T567I

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000107971
Gene: ENSMUSG00000055817
AA Change: T567I

DomainStartEndE-ValueType
BAH 4 147 2.62e-30 SMART
ELM2 150 204 2.5e-17 SMART
SANT 267 316 7.94e-8 SMART
ZnF_GATA 372 426 8.33e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175920
Predicted Effect unknown
Transcript: ENSMUST00000176054
AA Change: T225I
SMART Domains Protein: ENSMUSP00000134775
Gene: ENSMUSG00000055817
AA Change: T225I

DomainStartEndE-ValueType
ZnF_GATA 31 85 8.33e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176816
SMART Domains Protein: ENSMUSP00000135752
Gene: ENSMUSG00000055817

DomainStartEndE-ValueType
ELM2 1 52 3.23e-11 SMART
SANT 115 164 7.94e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177069
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Foxo3 T C 10: 42,197,820 I15V probably benign Het
Gm12888 A T 4: 121,318,350 D78E possibly damaging Het
Gm4952 T A 19: 12,618,406 N53K possibly damaging Het
Hrg A T 16: 22,961,148 probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Panx1 A G 9: 15,044,889 I50T probably damaging Het
Pdcd11 T C 19: 47,114,556 F1114L probably benign Het
Phf6 C G X: 52,953,558 Q279E probably benign Het
Phip A G 9: 82,915,399 V517A probably damaging Het
Psmb5 C T 14: 54,614,470 V86I probably damaging Het
R3hdm1 T A 1: 128,186,929 probably benign Het
Sfmbt1 A G 14: 30,773,893 I44M possibly damaging Het
Tmem89 A T 9: 108,914,800 D56V probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tshz3 T A 7: 36,768,753 C56S probably benign Het
Ttn C A 2: 76,947,940 A1322S probably damaging Het
Ubr3 C T 2: 70,003,380 H188Y probably damaging Het
Other mutations in Mta3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Mta3 APN 17 83708432 missense probably damaging 1.00
IGL00467:Mta3 APN 17 83755684 splice site probably benign
IGL00475:Mta3 APN 17 83708432 missense probably damaging 1.00
IGL00539:Mta3 APN 17 83762983 missense probably benign 0.25
IGL01722:Mta3 APN 17 83755643 missense possibly damaging 0.95
IGL03355:Mta3 APN 17 83800045 splice site probably benign
container UTSW 17 83708446 missense probably damaging 1.00
R0440:Mta3 UTSW 17 83766587 missense probably damaging 1.00
R0630:Mta3 UTSW 17 83714627 missense probably damaging 0.98
R1848:Mta3 UTSW 17 83755551 splice site probably benign
R1870:Mta3 UTSW 17 83781968 missense probably damaging 0.98
R2358:Mta3 UTSW 17 83762988 missense probably damaging 0.96
R2373:Mta3 UTSW 17 83784301 nonsense probably null
R3711:Mta3 UTSW 17 83762988 missense probably damaging 0.96
R3712:Mta3 UTSW 17 83762988 missense probably damaging 0.96
R4107:Mta3 UTSW 17 83762914 missense probably benign 0.00
R4771:Mta3 UTSW 17 83755674 missense probably damaging 0.98
R5259:Mta3 UTSW 17 83804574 missense probably damaging 1.00
R5980:Mta3 UTSW 17 83708405 missense probably damaging 1.00
R6175:Mta3 UTSW 17 83791793 missense probably benign
R6555:Mta3 UTSW 17 83708446 missense probably damaging 1.00
R6909:Mta3 UTSW 17 83766551 missense possibly damaging 0.92
R7170:Mta3 UTSW 17 83714662 missense probably damaging 1.00
R7350:Mta3 UTSW 17 83708441 missense probably damaging 1.00
R7597:Mta3 UTSW 17 83775582 missense probably benign 0.05
R7638:Mta3 UTSW 17 83800143 missense probably benign
R7747:Mta3 UTSW 17 83791736 nonsense probably null
R7894:Mta3 UTSW 17 83762934 missense probably benign 0.01
R7977:Mta3 UTSW 17 83762934 missense probably benign 0.01
Z1088:Mta3 UTSW 17 83762914 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGTGCGCCTATTAGCTGTG -3'
(R):5'- AGCAGCCTTACCCTTCATG -3'

Sequencing Primer
(F):5'- CGCCTATTAGCTGTGTTAGAGTC -3'
(R):5'- CAAACTCATTTGGTGGCCAG -3'
Posted On2014-11-12