Incidental Mutation 'R2863:Fxr2'
ID253043
Institutional Source Beutler Lab
Gene Symbol Fxr2
Ensembl Gene ENSMUSG00000018765
Gene Namefragile X mental retardation, autosomal homolog 2
SynonymsFxr2h
MMRRC Submission 040453-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.604) question?
Stock #R2863 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location69632990-69653297 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69639427 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 40 (I40N)
Ref Sequence ENSEMBL: ENSMUSP00000018909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018909]
Predicted Effect probably damaging
Transcript: ENSMUST00000018909
AA Change: I40N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018909
Gene: ENSMUSG00000018765
AA Change: I40N

DomainStartEndE-ValueType
Pfam:Agenet 72 130 1.3e-10 PFAM
KH 227 294 3.06e-3 SMART
KH 295 366 4.16e-5 SMART
low complexity region 368 380 N/A INTRINSIC
low complexity region 389 406 N/A INTRINSIC
low complexity region 423 442 N/A INTRINSIC
low complexity region 475 503 N/A INTRINSIC
Pfam:FXR_C1 504 579 2.5e-36 PFAM
low complexity region 586 599 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116923
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139605
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155513
Meta Mutation Damage Score 0.7861 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a RNA binding protein containing two KH domains and one RCG box, which is similar to FMRP and FXR1. It associates with polyribosomes, predominantly with 60S large ribosomal subunits. This encoded protein may self-associate or interact with FMRP and FXR1. It may have a role in the development of fragile X mental retardation syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit hyperactivity, impaired Morris water task performance, and reductions in prepulse inhibition, contextual conditioned fear, and sensitivity to heat stimulus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A T 19: 45,885,957 N592K probably damaging Het
Bag5 T C 12: 111,710,595 T265A probably benign Het
Bmper A G 9: 23,483,941 N656S probably benign Het
Boc A G 16: 44,492,960 S514P probably benign Het
Ccdc114 T C 7: 45,948,312 S549P probably benign Het
Ddx6 G T 9: 44,614,256 L103F probably damaging Het
Epb41l3 C T 17: 69,210,321 P115S probably benign Het
Exoc6 T C 19: 37,653,413 F709S probably benign Het
Fnip1 T C 11: 54,502,424 I562T probably damaging Het
Ifna6 G C 4: 88,827,862 R149S probably benign Het
Ifna6 C A 4: 88,827,849 T145K probably benign Het
Ldb2 T C 5: 44,480,324 Q214R probably damaging Het
Mus81 T G 19: 5,486,500 Y146S probably damaging Het
Myh11 T C 16: 14,239,426 I335V probably benign Het
Nid2 G A 14: 19,768,403 E322K possibly damaging Het
Ofcc1 A T 13: 40,072,760 S765R probably damaging Het
Ofcc1 T A 13: 40,087,938 H698L possibly damaging Het
Olfr923 T A 9: 38,828,539 F283I possibly damaging Het
Otog T G 7: 46,269,306 C935W probably damaging Het
Pcdhga3 T C 18: 37,674,590 V32A probably damaging Het
Phc3 C T 3: 30,914,128 D920N probably damaging Het
Pou6f1 A G 15: 100,580,808 probably null Het
Ppp4c A T 7: 126,792,100 I20N probably damaging Het
Prkag2 T A 5: 25,021,792 T156S probably benign Het
Psd T C 19: 46,314,762 D95G probably damaging Het
Riox2 A G 16: 59,489,393 D370G probably damaging Het
Spink14 T A 18: 44,030,881 C39S probably damaging Het
Tdrd9 T C 12: 112,031,261 V728A probably benign Het
Tgm2 T C 2: 158,143,099 E29G probably benign Het
Wdr35 T A 12: 9,028,060 Y1139* probably null Het
Wdr95 T A 5: 149,581,856 C367* probably null Het
Zfp35 T A 18: 24,004,295 D565E probably damaging Het
Other mutations in Fxr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00469:Fxr2 APN 11 69642139 missense possibly damaging 0.77
IGL00595:Fxr2 APN 11 69649192 missense probably benign 0.01
IGL00659:Fxr2 APN 11 69640250 missense probably benign 0.12
IGL00921:Fxr2 APN 11 69652240 missense probably damaging 1.00
IGL01025:Fxr2 APN 11 69643887 missense probably damaging 1.00
IGL01154:Fxr2 APN 11 69641433 splice site probably benign
IGL01347:Fxr2 APN 11 69652288 missense probably benign 0.27
IGL01743:Fxr2 APN 11 69652622 missense possibly damaging 0.53
IGL01981:Fxr2 APN 11 69650502 missense possibly damaging 0.95
IGL02332:Fxr2 APN 11 69649838 critical splice donor site probably null
IGL02385:Fxr2 APN 11 69652269 missense possibly damaging 0.82
IGL03172:Fxr2 APN 11 69649839 critical splice donor site probably null
R0092:Fxr2 UTSW 11 69642146 splice site probably benign
R0720:Fxr2 UTSW 11 69639415 missense probably benign 0.03
R1112:Fxr2 UTSW 11 69652248 missense probably damaging 1.00
R1344:Fxr2 UTSW 11 69648884 missense possibly damaging 0.68
R1635:Fxr2 UTSW 11 69641313 missense possibly damaging 0.77
R1864:Fxr2 UTSW 11 69652277 missense probably benign 0.30
R1957:Fxr2 UTSW 11 69643940 missense probably benign 0.03
R1992:Fxr2 UTSW 11 69649833 missense possibly damaging 0.92
R2243:Fxr2 UTSW 11 69642070 missense possibly damaging 0.93
R2865:Fxr2 UTSW 11 69639427 missense probably damaging 1.00
R5255:Fxr2 UTSW 11 69643841 missense probably benign 0.03
R5726:Fxr2 UTSW 11 69633346 missense probably benign 0.00
R5899:Fxr2 UTSW 11 69652685 missense probably damaging 1.00
R6045:Fxr2 UTSW 11 69651051 missense possibly damaging 0.90
R6146:Fxr2 UTSW 11 69641339 missense possibly damaging 0.82
R6149:Fxr2 UTSW 11 69649204 missense probably benign 0.05
R6195:Fxr2 UTSW 11 69652273 missense probably benign 0.30
R6622:Fxr2 UTSW 11 69641590 critical splice donor site probably null
R7381:Fxr2 UTSW 11 69642049 missense possibly damaging 0.89
R7382:Fxr2 UTSW 11 69641556 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCTGGCGATGTTTACTCTGC -3'
(R):5'- CACCAGATCCTGTTCCATAGTGG -3'

Sequencing Primer
(F):5'- GGCGATGTTTACTCTGCTCACATC -3'
(R):5'- ATCCTTGCTACCAACTATCAAGTG -3'
Posted On2014-12-04