Incidental Mutation 'R0314:Car9'
ID 25363
Institutional Source Beutler Lab
Gene Symbol Car9
Ensembl Gene ENSMUSG00000028463
Gene Name carbonic anhydrase 9
Synonyms CAIX, MN/CA9
MMRRC Submission 038524-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0314 (G1)
Quality Score 217
Status Validated
Chromosome 4
Chromosomal Location 43507026-43513729 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 43509212 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000030183]
AlphaFold Q8VHB5
Predicted Effect probably null
Transcript: ENSMUST00000030183
SMART Domains Protein: ENSMUSP00000030183
Gene: ENSMUSG00000028463

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 61 80 N/A INTRINSIC
Carb_anhydrase 120 369 2.72e-103 SMART
Blast:Carb_anhydrase 378 427 7e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124114
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128232
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129996
Predicted Effect probably null
Transcript: ENSMUST00000138073
SMART Domains Protein: ENSMUSP00000114493
Gene: ENSMUSG00000028463

DomainStartEndE-ValueType
Carb_anhydrase 35 237 6.18e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139119
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149817
Meta Mutation Damage Score 0.9476 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.9%
  • 20x: 88.7%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. CA IX is a transmembrane protein and is one of only two tumor-associated carbonic anhydrase isoenzymes known. It is expressed in all clear-cell renal cell carcinoma, but is not detected in normal kidney or most other normal tissues. It may be involved in cell proliferation and transformation. This gene was mapped to 17q21.2 by fluorescence in situ hybridization, however, radiation hybrid mapping localized it to 9p13-p12. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for a targeted mutation are viable and fertile but develop hyperplasia of the glandular gastric epithelium with numerous cysts. Mice homozygous for a different mutation show an increased mean percentage of mature B cells in bone marrow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arih2 T C 9: 108,485,878 (GRCm39) N345D probably damaging Het
Ascc3 C T 10: 50,514,095 (GRCm39) S298L possibly damaging Het
Cacna1e A G 1: 154,317,997 (GRCm39) Y1462H probably damaging Het
Cenpc1 A T 5: 86,185,230 (GRCm39) M427K probably benign Het
Chl1 T A 6: 103,624,262 (GRCm39) C57S probably damaging Het
Cntn3 T C 6: 102,397,342 (GRCm39) Y77C probably damaging Het
Cobll1 T C 2: 64,919,865 (GRCm39) K1187E possibly damaging Het
Fkbpl C T 17: 34,865,026 (GRCm39) H265Y possibly damaging Het
Fmo1 T G 1: 162,687,031 (GRCm39) E32A probably damaging Het
Fnip2 G A 3: 79,388,496 (GRCm39) T715I probably damaging Het
Fzd6 T A 15: 38,889,128 (GRCm39) I82K possibly damaging Het
Grm5 T C 7: 87,252,163 (GRCm39) S138P probably damaging Het
Klra5 T C 6: 129,880,553 (GRCm39) Y115C probably damaging Het
Lgr4 T C 2: 109,821,438 (GRCm39) probably benign Het
Limd1 T G 9: 123,345,892 (GRCm39) I557S probably benign Het
Mpv17l A T 16: 13,758,863 (GRCm39) I96L probably benign Het
Neb A T 2: 52,133,343 (GRCm39) D3398E probably benign Het
Nup155 T C 15: 8,176,736 (GRCm39) S1005P probably benign Het
Or2v2 A T 11: 49,004,519 (GRCm39) D11E possibly damaging Het
Or52a5b T C 7: 103,417,388 (GRCm39) D72G probably damaging Het
Pebp4 G T 14: 70,297,103 (GRCm39) S214I possibly damaging Het
Pex26 T C 6: 121,161,443 (GRCm39) probably null Het
Rbbp8 A T 18: 11,848,875 (GRCm39) Q230L probably benign Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Robo2 G A 16: 73,753,525 (GRCm39) T784M probably damaging Het
Slc5a1 T C 5: 33,303,995 (GRCm39) I270T probably benign Het
Spag4 C T 2: 155,909,229 (GRCm39) probably benign Het
Stt3a T C 9: 36,660,841 (GRCm39) probably benign Het
Svep1 C T 4: 58,096,331 (GRCm39) E1430K possibly damaging Het
Timd5 G A 11: 46,419,364 (GRCm39) C60Y probably damaging Het
Uba6 A T 5: 86,265,946 (GRCm39) V956E probably damaging Het
Ube2j1 T A 4: 33,043,991 (GRCm39) probably benign Het
Ubr5 A G 15: 37,997,431 (GRCm39) S1741P probably damaging Het
Vmn2r1 A G 3: 63,993,980 (GRCm39) T109A probably damaging Het
Vmn2r60 T C 7: 41,784,985 (GRCm39) probably benign Het
Vstm2a A G 11: 16,318,388 (GRCm39) probably benign Het
Zdhhc20 T A 14: 58,094,076 (GRCm39) K195N probably damaging Het
Zfp683 A G 4: 133,786,052 (GRCm39) Y393C probably benign Het
Zzz3 T C 3: 152,133,085 (GRCm39) S48P probably benign Het
Other mutations in Car9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01678:Car9 APN 4 43,512,941 (GRCm39) splice site probably benign
IGL01893:Car9 APN 4 43,510,252 (GRCm39) missense probably damaging 1.00
IGL02064:Car9 APN 4 43,507,363 (GRCm39) missense probably benign
R0122:Car9 UTSW 4 43,512,206 (GRCm39) missense probably benign 0.05
R0497:Car9 UTSW 4 43,511,881 (GRCm39) missense probably damaging 1.00
R1018:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1132:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1218:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1219:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1222:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1350:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1351:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1352:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1353:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1389:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1417:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1470:Car9 UTSW 4 43,510,222 (GRCm39) missense probably damaging 1.00
R1470:Car9 UTSW 4 43,510,222 (GRCm39) missense probably damaging 1.00
R1573:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1818:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1819:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R4033:Car9 UTSW 4 43,508,624 (GRCm39) missense possibly damaging 0.52
R4597:Car9 UTSW 4 43,509,138 (GRCm39) missense probably damaging 1.00
R4609:Car9 UTSW 4 43,507,267 (GRCm39) missense possibly damaging 0.81
R4719:Car9 UTSW 4 43,508,616 (GRCm39) nonsense probably null
R5402:Car9 UTSW 4 43,510,213 (GRCm39) missense probably damaging 1.00
R5624:Car9 UTSW 4 43,509,146 (GRCm39) missense probably benign 0.03
R6471:Car9 UTSW 4 43,511,938 (GRCm39) missense probably damaging 1.00
R6850:Car9 UTSW 4 43,507,321 (GRCm39) missense probably damaging 0.96
R7318:Car9 UTSW 4 43,513,089 (GRCm39) missense probably damaging 0.99
R7680:Car9 UTSW 4 43,507,250 (GRCm39) missense probably damaging 0.96
R8378:Car9 UTSW 4 43,509,021 (GRCm39) missense probably damaging 1.00
R9313:Car9 UTSW 4 43,507,180 (GRCm39) missense probably benign 0.03
X0067:Car9 UTSW 4 43,507,198 (GRCm39) missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- ACACACAGTCAATGGTCACCGTTTC -3'
(R):5'- AACTGGTCCATACTCCAGCCTTGC -3'

Sequencing Primer
(F):5'- ACCGTTTCCCTGCTGAGG -3'
(R):5'- GTCACTTATGACTGTCAAGACAGC -3'
Posted On 2013-04-16