Incidental Mutation 'R1353:Car9'
ID 157084
Institutional Source Beutler Lab
Gene Symbol Car9
Ensembl Gene ENSMUSG00000028463
Gene Name carbonic anhydrase 9
Synonyms CAIX, MN/CA9
MMRRC Submission 039418-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1353 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 43507026-43513729 bp(+) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 43512439 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000030183] [ENSMUST00000030184] [ENSMUST00000107913] [ENSMUST00000107914]
AlphaFold Q8VHB5
Predicted Effect probably null
Transcript: ENSMUST00000030183
SMART Domains Protein: ENSMUSP00000030183
Gene: ENSMUSG00000028463

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 61 80 N/A INTRINSIC
Carb_anhydrase 120 369 2.72e-103 SMART
Blast:Carb_anhydrase 378 427 7e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000030184
SMART Domains Protein: ENSMUSP00000030184
Gene: ENSMUSG00000028464

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 3.3e-39 PFAM
Pfam:Tropomyosin 48 284 1.5e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107913
SMART Domains Protein: ENSMUSP00000103546
Gene: ENSMUSG00000028464

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 6.5e-36 PFAM
Pfam:Tropomyosin 48 284 4.8e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107914
SMART Domains Protein: ENSMUSP00000103547
Gene: ENSMUSG00000028464

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 7.2e-39 PFAM
Pfam:Tropomyosin 48 284 6.3e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124114
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128232
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129996
Predicted Effect probably null
Transcript: ENSMUST00000138073
SMART Domains Protein: ENSMUSP00000114493
Gene: ENSMUSG00000028463

DomainStartEndE-ValueType
Carb_anhydrase 35 237 6.18e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149817
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139119
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150262
Meta Mutation Damage Score 0.9489 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.1%
  • 20x: 86.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. CA IX is a transmembrane protein and is one of only two tumor-associated carbonic anhydrase isoenzymes known. It is expressed in all clear-cell renal cell carcinoma, but is not detected in normal kidney or most other normal tissues. It may be involved in cell proliferation and transformation. This gene was mapped to 17q21.2 by fluorescence in situ hybridization, however, radiation hybrid mapping localized it to 9p13-p12. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for a targeted mutation are viable and fertile but develop hyperplasia of the glandular gastric epithelium with numerous cysts. Mice homozygous for a different mutation show an increased mean percentage of mature B cells in bone marrow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Astn2 T C 4: 66,184,572 (GRCm39) Q175R unknown Het
Capn9 A C 8: 125,332,305 (GRCm39) probably null Het
Chd7 A G 4: 8,839,556 (GRCm39) N1364S probably damaging Het
Cmya5 A T 13: 93,178,033 (GRCm39) V3607E probably damaging Het
Crb2 T C 2: 37,677,293 (GRCm39) C262R probably damaging Het
Cyp2t4 A G 7: 26,856,055 (GRCm39) N204S probably benign Het
Epha1 T C 6: 42,338,771 (GRCm39) T676A probably damaging Het
Fancm G A 12: 65,134,944 (GRCm39) V246M probably damaging Het
Fcrl5 T C 3: 87,355,669 (GRCm39) S461P probably damaging Het
Gen1 A T 12: 11,293,220 (GRCm39) L394Q probably benign Het
Hsdl2 G T 4: 59,596,971 (GRCm39) probably null Het
Klri2 C T 6: 129,716,049 (GRCm39) G97S probably damaging Het
Lypla2 T C 4: 135,697,778 (GRCm39) I55V probably null Het
Malrd1 A G 2: 16,132,779 (GRCm39) D1900G unknown Het
Map1b A G 13: 99,563,834 (GRCm39) S2378P unknown Het
Marchf3 A T 18: 56,909,177 (GRCm39) probably null Het
Myom2 G T 8: 15,156,424 (GRCm39) W757L probably damaging Het
Nat10 T A 2: 103,584,418 (GRCm39) M120L possibly damaging Het
Ncam2 T G 16: 80,997,803 (GRCm39) M1R probably null Het
Ncoa4 G T 14: 31,892,815 (GRCm39) G33* probably null Het
Or1j1 C A 2: 36,702,926 (GRCm39) M59I possibly damaging Het
Or1x2 G A 11: 50,917,833 (GRCm39) M1I probably null Het
Or2a20 T A 6: 43,194,624 (GRCm39) M259K probably benign Het
Or4p21 T C 2: 88,276,895 (GRCm39) H129R probably benign Het
Or6c38 C T 10: 128,929,733 (GRCm39) V37I probably benign Het
Or8b41 A C 9: 38,055,024 (GRCm39) I198L probably benign Het
Osbpl8 A G 10: 111,112,340 (GRCm39) N485S probably damaging Het
Pkdrej A T 15: 85,703,119 (GRCm39) V939E probably damaging Het
Plaa T C 4: 94,459,926 (GRCm39) E607G possibly damaging Het
Rtel1 T A 2: 180,991,024 (GRCm39) C285S probably benign Het
Rtl1 A C 12: 109,558,633 (GRCm39) C1069G probably benign Het
Rtn4 C A 11: 29,657,595 (GRCm39) A583E probably damaging Het
Runx1 T A 16: 92,485,939 (GRCm39) R32* probably null Het
Sdcbp A G 4: 6,381,057 (GRCm39) I67M probably damaging Het
Slc22a12 G C 19: 6,587,812 (GRCm39) L259V possibly damaging Het
Sptlc2 A G 12: 87,388,520 (GRCm39) S321P probably damaging Het
Tmem30c C T 16: 57,098,028 (GRCm39) G131D probably damaging Het
Tnfaip2 A T 12: 111,411,403 (GRCm39) Q9L probably damaging Het
Ttn T C 2: 76,576,910 (GRCm39) Y24661C probably damaging Het
Vmn2r77 T G 7: 86,451,394 (GRCm39) F427V probably benign Het
Zcchc4 A G 5: 52,964,419 (GRCm39) I292V probably benign Het
Zfp354b A T 11: 50,814,240 (GRCm39) H228Q probably damaging Het
Zfp84 T A 7: 29,475,600 (GRCm39) N97K probably benign Het
Zfp976 T C 7: 42,265,442 (GRCm39) D49G probably damaging Het
Zgrf1 C T 3: 127,405,452 (GRCm39) T1550I probably damaging Het
Other mutations in Car9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01678:Car9 APN 4 43,512,941 (GRCm39) splice site probably benign
IGL01893:Car9 APN 4 43,510,252 (GRCm39) missense probably damaging 1.00
IGL02064:Car9 APN 4 43,507,363 (GRCm39) missense probably benign
R0122:Car9 UTSW 4 43,512,206 (GRCm39) missense probably benign 0.05
R0314:Car9 UTSW 4 43,509,212 (GRCm39) critical splice donor site probably null
R0497:Car9 UTSW 4 43,511,881 (GRCm39) missense probably damaging 1.00
R1018:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1132:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1218:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1219:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1222:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1350:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1351:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1352:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1389:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1417:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1470:Car9 UTSW 4 43,510,222 (GRCm39) missense probably damaging 1.00
R1470:Car9 UTSW 4 43,510,222 (GRCm39) missense probably damaging 1.00
R1573:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1818:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1819:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R4033:Car9 UTSW 4 43,508,624 (GRCm39) missense possibly damaging 0.52
R4597:Car9 UTSW 4 43,509,138 (GRCm39) missense probably damaging 1.00
R4609:Car9 UTSW 4 43,507,267 (GRCm39) missense possibly damaging 0.81
R4719:Car9 UTSW 4 43,508,616 (GRCm39) nonsense probably null
R5402:Car9 UTSW 4 43,510,213 (GRCm39) missense probably damaging 1.00
R5624:Car9 UTSW 4 43,509,146 (GRCm39) missense probably benign 0.03
R6471:Car9 UTSW 4 43,511,938 (GRCm39) missense probably damaging 1.00
R6850:Car9 UTSW 4 43,507,321 (GRCm39) missense probably damaging 0.96
R7318:Car9 UTSW 4 43,513,089 (GRCm39) missense probably damaging 0.99
R7680:Car9 UTSW 4 43,507,250 (GRCm39) missense probably damaging 0.96
R8378:Car9 UTSW 4 43,509,021 (GRCm39) missense probably damaging 1.00
R9313:Car9 UTSW 4 43,507,180 (GRCm39) missense probably benign 0.03
X0067:Car9 UTSW 4 43,507,198 (GRCm39) missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TCGTGATTCTCGGCTACAACTGAAC -3'
(R):5'- CTTCCAGCAGCTAGGTGAAAGGTG -3'

Sequencing Primer
(F):5'- ACCCTTGAATGGGCGAAC -3'
(R):5'- AGATTTCTGGAGCCTCATTCAGAC -3'
Posted On 2014-02-11