Mutagenetix > Incidental Mutation

Incidental Mutation 'R2945:Acd'

255845

Institutional Source

Beutler Lab

Gene Symbol

Acd

Ensembl Gene

ENSMUSG00000038000

Gene Name

adrenocortical dysplasia

Synonyms

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.443) question?

Stock #

R2945 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

106424789-106427748 bp(-) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 106426927 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 132 (Q132*)

Ref Sequence

ENSEMBL: ENSMUSP00000148285 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000013299] [ENSMUST00000042608] [ENSMUST00000062574] [ENSMUST00000093195] [ENSMUST00000098444] [ENSMUST00000211870] [ENSMUST00000211888] [ENSMUST00000212352] [ENSMUST00000212061] [ENSMUST00000213019] [ENSMUST00000212642] [ENSMUST00000212650] [ENSMUST00000212430]

AlphaFold

Q5EE38

Predicted Effect

probably benign
Transcript: ENSMUST00000013299

SMART Domains

Protein: ENSMUSP00000013299
Gene: ENSMUSG00000013155

Domain	Start	End	E-Value	Type
low complexity region	220	236	N/A	INTRINSIC
Pfam:Enkurin	243	339	6.3e-26	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000042608
AA Change: Q132*

SMART Domains

Protein: ENSMUSP00000048180
Gene: ENSMUSG00000038000
AA Change: Q132*

Domain	Start	End	E-Value	Type
Pfam:TPP1	11	118	2.4e-23	PFAM
low complexity region	259	272	N/A	INTRINSIC
low complexity region	296	319	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000062574

SMART Domains

Protein: ENSMUSP00000052322
Gene: ENSMUSG00000050357

Domain	Start	End	E-Value	Type
Pfam:CARMIL_C	149	442	3.3e-62	PFAM
low complexity region	467	484	N/A	INTRINSIC
low complexity region	631	659	N/A	INTRINSIC
low complexity region	696	727	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000093195

SMART Domains

Protein: ENSMUSP00000090886
Gene: ENSMUSG00000005699

Domain	Start	End	E-Value	Type
PB1	15	95	2.81e-15	SMART
PDZ	167	250	1.38e-12	SMART
low complexity region	263	286	N/A	INTRINSIC
low complexity region	309	323	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000098444

SMART Domains

Protein: ENSMUSP00000096043
Gene: ENSMUSG00000005699

Domain	Start	End	E-Value	Type
PB1	4	79	1.28e-9	SMART
PDZ	151	234	1.38e-12	SMART
low complexity region	247	270	N/A	INTRINSIC
low complexity region	293	307	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000211870
AA Change: Q132*

Predicted Effect

probably benign
Transcript: ENSMUST00000211888

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212643

Predicted Effect

probably benign
Transcript: ENSMUST00000212352

Predicted Effect

probably benign
Transcript: ENSMUST00000212061

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212716

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212687

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212162

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212972

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212634

Predicted Effect

probably benign
Transcript: ENSMUST00000213019

Predicted Effect

probably benign
Transcript: ENSMUST00000212642

Predicted Effect

probably benign
Transcript: ENSMUST00000212650

Predicted Effect

probably benign
Transcript: ENSMUST00000212430

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in telomere function. This protein is one of six core proteins in the telosome/shelterin telomeric complex, which functions to maintain telomere length and to protect telomere ends. Through its interaction with other components, this protein plays a key role in the assembly and stabilization of this complex, and it mediates the access of telomerase to the telomere. Multiple transcript variants encoding different isoforms have been found for this gene. This gene, which is also referred to as TPP1, is distinct from the unrelated TPP1 gene on chromosome 11, which encodes tripeptidyl-peptidase I. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene produce skeletal, coat, vibrissae and skin pigmentation defects. Kidney and adrenal abnormalities cause a shortened lifespan. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 8 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bag4	C	T	8: 26,261,280 (GRCm39)	A154T	probably benign	Het
Caprin1	A	G	2: 103,603,154 (GRCm39)	S470P	probably benign	Het
Dsg3	A	G	18: 20,672,992 (GRCm39)	T888A	probably benign	Het
Fam111a	C	A	19: 12,565,230 (GRCm39)	C326*	probably null	Het
Nbeal2	A	G	9: 110,457,136 (GRCm39)	V2310A	possibly damaging	Het
Purg	T	A	8: 33,876,671 (GRCm39)	I103N	probably damaging	Het
Unc5c	A	T	3: 141,495,735 (GRCm39)	N461Y	probably damaging	Het
Utrn	T	C	10: 12,362,135 (GRCm39)	T290A	possibly damaging	Het

Other mutations in Acd

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00326:Acd	APN	8	106,425,086 (GRCm39)	missense	probably damaging	1.00
IGL02322:Acd	APN	8	106,425,268 (GRCm39)	missense	probably benign	0.04
R0613:Acd	UTSW	8	106,427,200 (GRCm39)	splice site	probably null
R1750:Acd	UTSW	8	106,425,524 (GRCm39)	missense	possibly damaging	0.93
R1824:Acd	UTSW	8	106,427,122 (GRCm39)	missense	probably damaging	1.00
R1870:Acd	UTSW	8	106,425,039 (GRCm39)	critical splice donor site	probably null
R2888:Acd	UTSW	8	106,425,470 (GRCm39)	missense	probably benign	0.08
R3001:Acd	UTSW	8	106,426,913 (GRCm39)	critical splice donor site	probably null
R3002:Acd	UTSW	8	106,426,913 (GRCm39)	critical splice donor site	probably null
R3003:Acd	UTSW	8	106,426,913 (GRCm39)	critical splice donor site	probably null
R4795:Acd	UTSW	8	106,427,647 (GRCm39)	missense	possibly damaging	0.92
R4806:Acd	UTSW	8	106,424,922 (GRCm39)	missense	possibly damaging	0.75
R6111:Acd	UTSW	8	106,424,919 (GRCm39)	missense	probably benign	0.04
R6236:Acd	UTSW	8	106,427,127 (GRCm39)	missense	probably benign	0.01
R7096:Acd	UTSW	8	106,425,121 (GRCm39)	missense	possibly damaging	0.52
R8677:Acd	UTSW	8	106,427,576 (GRCm39)	missense	probably damaging	1.00
R8995:Acd	UTSW	8	106,427,131 (GRCm39)	missense	probably damaging	1.00
R9272:Acd	UTSW	8	106,424,952 (GRCm39)	missense	probably damaging	1.00
R9307:Acd	UTSW	8	106,425,514 (GRCm39)	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TATGCCAAGTGCGCGTGAAG -3'
(R):5'- TGTGCTCTGGACAATGAGG -3'

Sequencing Primer
(F):5'- GAGACAAAAGGTGGAAGCTTC -3'
(R):5'- ACAATGAGGGCTGTGCTC -3'

Posted On

2014-12-29