Incidental Mutation 'R2909:Tnfrsf18'
ID261130
Institutional Source Beutler Lab
Gene Symbol Tnfrsf18
Ensembl Gene ENSMUSG00000041954
Gene Nametumor necrosis factor receptor superfamily, member 18
SynonymsGitr
MMRRC Submission 040496-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2909 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location156026164-156028895 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 156028270 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 138 (N138Y)
Ref Sequence ENSEMBL: ENSMUSP00000113277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040274] [ENSMUST00000103173] [ENSMUST00000122001]
Predicted Effect probably benign
Transcript: ENSMUST00000040274
SMART Domains Protein: ENSMUSP00000040035
Gene: ENSMUSG00000041954

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Blast:TNFR 29 62 2e-6 BLAST
EGF 76 117 2.29e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000103173
AA Change: N138Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099462
Gene: ENSMUSG00000041954
AA Change: N138Y

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TNFR 62 100 2.92e1 SMART
EGF 76 117 2.29e1 SMART
TNFR 103 141 5.56e-3 SMART
transmembrane domain 156 178 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122001
AA Change: N138Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113277
Gene: ENSMUSG00000041954
AA Change: N138Y

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TNFR 62 100 2.92e1 SMART
EGF 76 117 2.29e1 SMART
TNFR 103 141 5.56e-3 SMART
transmembrane domain 156 178 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125100
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141260
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181389
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the TNF-receptor superfamily. The encoded receptor has been shown to have increased expression upon T-cell activation, and it is thought to play a key role in dominant immunological self-tolerance maintained by CD25(+)CD4(+) regulatory T cells. Knockout studies in mice also suggest the role of this receptor is in the regulation of CD3-driven T-cell activation and programmed cell death. Three alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a targeted mutation display dysregulation of T-cell receptor/CD3-driven T-cell activation and programmed cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,947,953 D1349G probably damaging Het
Actr5 G A 2: 158,625,220 G27R possibly damaging Het
AF529169 T C 9: 89,591,278 N860S probably damaging Het
Chrm3 G T 13: 9,877,997 D334E probably benign Het
Clic5 A C 17: 44,275,259 T212P probably benign Het
Dapk1 G A 13: 60,716,817 probably null Het
Dync2h1 A T 9: 7,049,114 L3262H probably damaging Het
Epg5 G C 18: 77,983,476 W1227C probably damaging Het
Fancm T C 12: 65,124,856 S1757P probably damaging Het
Gm3604 G C 13: 62,369,018 H509D probably benign Het
Gramd4 G T 15: 86,122,183 E163* probably null Het
Hip1r T A 5: 124,000,593 probably null Het
Ice1 G T 13: 70,596,173 T2097K probably damaging Het
Il12a TCAC TC 3: 68,697,987 probably null Het
Kbtbd7 A G 14: 79,428,482 T585A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnq3 T C 15: 66,025,236 T272A possibly damaging Het
Ly6l T G 15: 75,449,632 probably null Het
Mrps11 C A 7: 78,788,749 A83E probably damaging Het
Olfr366 C T 2: 37,220,176 P229L probably damaging Het
Pax7 T C 4: 139,828,696 I156V possibly damaging Het
Plbd1 A T 6: 136,634,574 V235D probably damaging Het
Pml T C 9: 58,247,243 S76G possibly damaging Het
Ppp1r42 T A 1: 10,003,412 probably benign Het
Rsl24d1 T C 9: 73,122,303 L61S probably damaging Het
Rtp2 T C 16: 23,927,485 E132G probably damaging Het
Sgk1 A G 10: 21,994,816 I23V probably benign Het
Sharpin A G 15: 76,350,611 probably benign Het
Sipa1l1 T A 12: 82,357,331 Y533N probably benign Het
Slc12a9 T C 5: 137,332,201 I81V probably benign Het
Stxbp5l G A 16: 37,208,186 T505M possibly damaging Het
Tmem40 A G 6: 115,736,381 probably null Het
Vmn2r87 A T 10: 130,478,996 N240K probably damaging Het
Vmn2r91 A G 17: 18,136,399 E776G probably damaging Het
Vmn2r92 T A 17: 18,185,115 N840K possibly damaging Het
Vmn2r98 T C 17: 19,067,402 I499T probably damaging Het
Other mutations in Tnfrsf18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Tnfrsf18 APN 4 156028036 nonsense probably null
R0100:Tnfrsf18 UTSW 4 156028366 missense probably benign 0.15
R0100:Tnfrsf18 UTSW 4 156028366 missense probably benign 0.15
R0311:Tnfrsf18 UTSW 4 156026415 missense possibly damaging 0.95
R0624:Tnfrsf18 UTSW 4 156026529 missense possibly damaging 0.94
R1158:Tnfrsf18 UTSW 4 156028282 missense probably benign 0.29
R2117:Tnfrsf18 UTSW 4 156028516 missense probably damaging 0.99
R4610:Tnfrsf18 UTSW 4 156021880 unclassified probably benign
R5307:Tnfrsf18 UTSW 4 156028424 critical splice donor site probably null
R6571:Tnfrsf18 UTSW 4 156028319 nonsense probably null
R7111:Tnfrsf18 UTSW 4 156028711 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGTAGCCTAGGCCCGTTCTAAG -3'
(R):5'- GCCTGAGACACATTTTCCCC -3'

Sequencing Primer
(F):5'- TAGGCCCGTTCTAAGAAAGC -3'
(R):5'- CTTCCCTGGGACACAACTG -3'
Posted On2015-01-23