Incidental Mutation 'R3036:Ly6f'
ID263376
Institutional Source Beutler Lab
Gene Symbol Ly6f
Ensembl Gene ENSMUSG00000022583
Gene Namelymphocyte antigen 6 complex, locus F
Synonyms
MMRRC Submission 040552-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R3036 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location75268421-75272235 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75268787 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 20 (C20R)
Ref Sequence ENSEMBL: ENSMUSP00000140899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023247] [ENSMUST00000189654]
Predicted Effect probably damaging
Transcript: ENSMUST00000023247
AA Change: C20R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023247
Gene: ENSMUSG00000022583
AA Change: C20R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 118 1.94e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000189654
AA Change: C20R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140899
Gene: ENSMUSG00000022583
AA Change: C20R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 118 1.94e-35 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg10 A G 13: 91,040,898 S98P probably damaging Het
Caskin2 A G 11: 115,806,356 Y189H probably damaging Het
Ces2b A G 8: 104,834,626 I143V possibly damaging Het
Gpr108 A G 17: 57,245,323 V90A probably benign Het
Kcnk18 T A 19: 59,235,062 V213D probably benign Het
Mbl1 C A 14: 41,158,833 S226Y probably damaging Het
Mdn1 T C 4: 32,750,013 C4399R probably damaging Het
Myadm A G 7: 3,297,543 T274A probably benign Het
Nol11 A G 11: 107,173,244 S561P possibly damaging Het
Pbld2 T C 10: 63,071,446 S155P probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Sumf1 G A 6: 108,153,191 A214V possibly damaging Het
Teddm1a A G 1: 153,891,910 Y40C probably benign Het
Tgm2 C T 2: 158,124,247 G496S probably benign Het
Trpm5 G A 7: 143,085,463 T239I probably benign Het
Ttn C A 2: 76,900,616 probably benign Het
Uty G A Y: 1,099,671 R1112* probably null Het
Other mutations in Ly6f
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0480:Ly6f UTSW 15 75271677 missense probably damaging 1.00
R1084:Ly6f UTSW 15 75268773 missense probably damaging 1.00
R3113:Ly6f UTSW 15 75271728 missense probably benign 0.28
R4549:Ly6f UTSW 15 75271730 missense probably benign
R4824:Ly6f UTSW 15 75271720 missense probably damaging 0.99
R5148:Ly6f UTSW 15 75271797 missense probably benign
R5211:Ly6f UTSW 15 75271803 missense probably damaging 1.00
R5295:Ly6f UTSW 15 75271639 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- GGCAGACATGTATTCCTTGGG -3'
(R):5'- GGTTACAGACCCAGTAAAGCAC -3'

Sequencing Primer
(F):5'- CCTTGGGGAAAGCTGGG -3'
(R):5'- GCACACAACACATGAGGCTTC -3'
Posted On2015-02-05