Incidental Mutation 'R3438:Gm12666'
ID267274
Institutional Source Beutler Lab
Gene Symbol Gm12666
Ensembl Gene ENSMUSG00000066107
Gene Namepredicted gene 12666
Synonyms
MMRRC Submission 040656-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.331) question?
Stock #R3438 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location92190744-92191749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 92191682 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 23 (V23G)
Ref Sequence ENSEMBL: ENSMUSP00000122212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123179]
Predicted Effect possibly damaging
Transcript: ENSMUST00000123179
AA Change: V23G

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122212
Gene: ENSMUSG00000066107
AA Change: V23G

DomainStartEndE-ValueType
RRM 3 73 9.8e-9 SMART
low complexity region 87 103 N/A INTRINSIC
low complexity region 134 153 N/A INTRINSIC
low complexity region 179 188 N/A INTRINSIC
low complexity region 228 246 N/A INTRINSIC
Meta Mutation Damage Score 0.4212 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017G19Rik A G 3: 40,521,524 noncoding transcript Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Ampd3 T C 7: 110,803,226 I479T probably damaging Het
Aoah G A 13: 20,917,072 R254K probably benign Het
Appbp2 T C 11: 85,198,140 E358G probably damaging Het
Col6a5 A G 9: 105,875,792 S2294P possibly damaging Het
Cux1 T C 5: 136,311,560 E632G probably damaging Het
Cyp7a1 T C 4: 6,272,769 N148S probably damaging Het
Dgkz A T 2: 91,934,050 probably benign Het
Dlgap1 A T 17: 70,516,361 S114C probably damaging Het
Dmtn T A 14: 70,612,716 I263F probably damaging Het
Gigyf2 C A 1: 87,440,580 H1029N probably damaging Het
Gm10770 T A 2: 150,179,549 probably null Het
Gnb1l A G 16: 18,552,367 T203A probably benign Het
Kng2 T C 16: 23,012,071 I163V probably benign Het
Lamc1 T C 1: 153,226,415 D1479G probably benign Het
Lhx4 T A 1: 155,702,484 D304V probably benign Het
Mybl1 G T 1: 9,687,645 T143K probably damaging Het
Notch3 C T 17: 32,153,590 C630Y probably damaging Het
Oas1e T C 5: 120,795,410 E30G probably damaging Het
Olfr1219 T C 2: 89,074,363 I243V probably benign Het
Olfr311 G T 11: 58,841,872 G253* probably null Het
Olfr922 T G 9: 38,816,216 F238V probably damaging Het
Otoa A G 7: 121,160,343 E1056G possibly damaging Het
Plin4 A G 17: 56,107,193 V144A probably benign Het
Sec16b T C 1: 157,556,758 probably benign Het
Stk31 A G 6: 49,437,521 S485G probably benign Het
Tanc2 C T 11: 105,857,575 P511L probably damaging Het
Utrn T C 10: 12,481,318 D309G probably damaging Het
Vpreb3 C T 10: 75,943,222 probably benign Het
Vsx2 A T 12: 84,570,211 Q90L probably damaging Het
Other mutations in Gm12666
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01373:Gm12666 APN 4 92191625 missense probably damaging 0.98
IGL01670:Gm12666 APN 4 92191500 splice site probably null
IGL02690:Gm12666 APN 4 92191011 missense probably damaging 0.98
IGL03052:Gm12666 UTSW 4 92191050 missense probably benign 0.01
R2094:Gm12666 UTSW 4 92191656 missense probably damaging 1.00
R2567:Gm12666 UTSW 4 92191323 missense probably benign 0.10
R3439:Gm12666 UTSW 4 92191682 missense possibly damaging 0.94
R4388:Gm12666 UTSW 4 92191114 missense probably benign 0.00
R4710:Gm12666 UTSW 4 92190975 missense possibly damaging 0.94
R5810:Gm12666 UTSW 4 92191583 critical splice donor site probably null
R6969:Gm12666 UTSW 4 92191589 missense probably damaging 1.00
R7486:Gm12666 UTSW 4 92191269 missense probably benign 0.11
X0067:Gm12666 UTSW 4 92191334 splice site probably null
Z1177:Gm12666 UTSW 4 92191236 missense possibly damaging 0.50
Z1177:Gm12666 UTSW 4 92191703 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATTTGTTACTCTTGCTAACCCTGTG -3'
(R):5'- AGTTACACACAGTTATTGCCACC -3'

Sequencing Primer
(F):5'- ACTCTTGCTAACCCTGTGCTTTTTC -3'
(R):5'- AGGAGTTGCTCCCCAAAA -3'
Posted On2015-02-18