Incidental Mutation 'R3691:Gzmg'
ID268797
Institutional Source Beutler Lab
Gene Symbol Gzmg
Ensembl Gene ENSMUSG00000040284
Gene Namegranzyme G
SynonymsCtla-7, Ctla7
MMRRC Submission 040686-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R3691 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location56156582-56159579 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 56157677 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000015578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015578]
Predicted Effect probably benign
Transcript: ENSMUST00000015578
SMART Domains Protein: ENSMUSP00000015578
Gene: ENSMUSG00000040284

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Tryp_SPc 20 241 6.39e-82 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224928
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn A G 17: 13,888,409 E1398G probably damaging Het
Avl9 C T 6: 56,736,827 H357Y probably benign Het
Best2 A G 8: 85,011,254 F171L probably benign Het
Btbd19 A T 4: 117,120,592 probably benign Het
Cap1 A G 4: 122,864,626 S254P probably damaging Het
Cfap43 G A 19: 47,897,073 L368F probably benign Het
Clasrp C A 7: 19,585,240 probably benign Het
Cog3 T C 14: 75,754,438 M1V probably null Het
Drosha G A 15: 12,834,638 R276H unknown Het
Efr3b T A 12: 3,982,059 D183V possibly damaging Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Epha1 T C 6: 42,361,130 T794A probably damaging Het
Fbxo17 G A 7: 28,737,462 V281I probably damaging Het
Flii T C 11: 60,719,757 Y571C probably benign Het
Flywch1 G A 17: 23,763,212 P6L probably damaging Het
Foxj3 T C 4: 119,616,642 probably benign Het
Fras1 C T 5: 96,781,512 T3925I probably benign Het
Gk5 T C 9: 96,129,096 probably null Het
Gm12588 T G 11: 121,905,925 Q366P possibly damaging Het
Gm3248 A G 14: 5,943,068 I161T probably damaging Het
Lrrc69 A T 4: 14,795,980 N22K possibly damaging Het
Med13l A G 5: 118,721,497 R250G probably benign Het
Mxi1 T C 19: 53,369,631 L73P probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Napb T C 2: 148,703,057 probably null Het
Nsun2 A G 13: 69,612,337 N45D probably damaging Het
Olfr1123 T C 2: 87,418,170 F39L probably benign Het
Oxct1 A G 15: 4,047,517 M111V probably benign Het
Pcnx4 A G 12: 72,573,719 D771G probably damaging Het
Serpina6 T C 12: 103,654,409 D27G probably benign Het
Tecpr1 A G 5: 144,209,979 F523S probably benign Het
Zan A G 5: 137,420,019 I2939T unknown Het
Zfc3h1 A G 10: 115,420,690 T1522A probably benign Het
Other mutations in Gzmg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02064:Gzmg APN 14 56157341 missense probably benign 0.00
IGL02323:Gzmg APN 14 56157272 missense probably benign 0.01
IGL02633:Gzmg APN 14 56156703 missense probably damaging 0.99
R0456:Gzmg UTSW 14 56158322 missense probably damaging 1.00
R1368:Gzmg UTSW 14 56157806 missense probably benign 0.41
R1663:Gzmg UTSW 14 56156808 missense probably damaging 1.00
R2511:Gzmg UTSW 14 56158375 missense probably benign 0.00
R4509:Gzmg UTSW 14 56156753 missense probably damaging 1.00
R6776:Gzmg UTSW 14 56156831 missense probably damaging 1.00
R7175:Gzmg UTSW 14 56159522 start codon destroyed probably null
R7502:Gzmg UTSW 14 56156827 missense not run
R8022:Gzmg UTSW 14 56157446 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- TTACTCTCCAGCTGGTAGGG -3'
(R):5'- CACAGCTCTTGCACTGCATC -3'

Sequencing Primer
(F):5'- TTACTCTCCAGCTGGTAGGGAAGAG -3'
(R):5'- TGCACTGCATCTTCTCTGAC -3'
Posted On2015-02-19