Incidental Mutation 'R3776:Crispld2'
ID273594
Institutional Source Beutler Lab
Gene Symbol Crispld2
Ensembl Gene ENSMUSG00000031825
Gene Namecysteine-rich secretory protein LCCL domain containing 2
Synonyms1810049K24Rik, Lgl1, coffeecrisp
MMRRC Submission 040874-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3776 (G1)
Quality Score165
Status Not validated
Chromosome8
Chromosomal Location119992438-120052793 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120029266 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 325 (S325P)
Ref Sequence ENSEMBL: ENSMUSP00000122962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034282] [ENSMUST00000108972] [ENSMUST00000127664] [ENSMUST00000132583]
Predicted Effect probably damaging
Transcript: ENSMUST00000034282
AA Change: S326P

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034282
Gene: ENSMUSG00000031825
AA Change: S326P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SCP 54 208 1.2e-48 SMART
LCCL 284 368 1.25e-45 SMART
LCCL 385 477 1.28e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108972
AA Change: S325P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104600
Gene: ENSMUSG00000031825
AA Change: S325P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SCP 54 208 1.2e-48 SMART
LCCL 283 367 1.25e-45 SMART
LCCL 384 476 1.28e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000132583
AA Change: S325P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122962
Gene: ENSMUSG00000031825
AA Change: S325P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SCP 54 208 1.2e-48 SMART
LCCL 283 367 1.25e-45 SMART
LCCL 384 476 1.28e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144801
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant mice show various immunological abnormalities, enhanced glucose tolerance and decreased bone-related measurements. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer1 C T 17: 56,955,111 V264M probably damaging Het
Adgrg1 C T 8: 95,009,655 S479F probably damaging Het
Ank2 T A 3: 126,942,262 probably benign Het
Atp2b1 CTTTTT CTTTTTT 10: 98,979,869 probably null Het
Ccdc88c G A 12: 100,947,179 T529M probably damaging Het
Cdc27 T G 11: 104,515,437 E617D probably damaging Het
Cfap54 A G 10: 93,045,100 V367A probably damaging Het
Col6a4 G A 9: 106,051,701 Q1445* probably null Het
Dll1 T C 17: 15,368,524 S630G probably benign Het
Ednra A G 8: 77,675,095 S189P probably damaging Het
Eif6 T A 2: 155,826,376 T20S possibly damaging Het
Fbxl5 A G 5: 43,758,276 V555A possibly damaging Het
Gdpd5 G A 7: 99,454,572 R422Q probably benign Het
Glt1d1 T A 5: 127,694,311 F289I probably damaging Het
Gm5565 T A 5: 146,158,609 E192V probably benign Het
Gpc5 T C 14: 115,370,060 M358T probably benign Het
Helz2 G A 2: 181,240,389 R204* probably null Het
Hhex A T 19: 37,437,270 Q149L probably damaging Het
Kat2b A G 17: 53,567,581 probably null Het
Kif23 G A 9: 61,924,992 S623L probably benign Het
Klra2 A T 6: 131,242,963 L85H probably benign Het
Krt32 A G 11: 100,088,121 C36R probably benign Het
Megf10 G A 18: 57,277,105 G653S probably damaging Het
Mpp3 G T 11: 102,023,367 S134* probably null Het
Mttp T C 3: 138,114,263 probably null Het
Mxi1 C A 19: 53,371,729 A294E probably benign Het
Nin G T 12: 70,038,682 Q1592K possibly damaging Het
Nlrc5 A G 8: 94,472,839 E26G possibly damaging Het
Nup160 G T 2: 90,722,076 C1132F probably benign Het
Olfr1234 A T 2: 89,362,764 S222T possibly damaging Het
Pdgfc A G 3: 81,141,551 T89A probably damaging Het
Pdgfrb A G 18: 61,081,920 D1007G probably benign Het
Pgbd1 A G 13: 21,428,373 L98P probably benign Het
Pkhd1l1 G A 15: 44,514,975 probably null Het
Plod1 A G 4: 147,931,277 V105A possibly damaging Het
Polg2 G T 11: 106,779,284 F53L probably benign Het
Ptprc T G 1: 138,064,773 Q1205H probably damaging Het
Rab3gap2 T C 1: 185,277,205 L1086P probably damaging Het
Rnf19a T A 15: 36,265,912 N13I probably benign Het
Slc25a19 A G 11: 115,615,459 Y303H probably damaging Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Trpm3 T C 19: 22,978,602 F1143L possibly damaging Het
Ubxn11 C T 4: 134,108,294 P4S probably damaging Het
Zg16 T A 7: 127,050,532 I86F probably damaging Het
Other mutations in Crispld2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Crispld2 APN 8 120033560 missense probably damaging 1.00
IGL00835:Crispld2 APN 8 120010648 missense probably damaging 1.00
IGL03209:Crispld2 APN 8 120031098 missense possibly damaging 0.88
IGL03324:Crispld2 APN 8 120015371 missense probably damaging 1.00
R0172:Crispld2 UTSW 8 120026071 missense possibly damaging 0.80
R0212:Crispld2 UTSW 8 120010631 missense probably benign
R0492:Crispld2 UTSW 8 120026067 missense probably benign 0.30
R1532:Crispld2 UTSW 8 120023572 missense probably benign
R1715:Crispld2 UTSW 8 120023649 missense possibly damaging 0.75
R1865:Crispld2 UTSW 8 120010567 missense probably benign 0.00
R1953:Crispld2 UTSW 8 120015296 missense probably damaging 1.00
R2161:Crispld2 UTSW 8 120015339 missense probably damaging 1.00
R2306:Crispld2 UTSW 8 120026071 missense probably damaging 0.99
R2851:Crispld2 UTSW 8 120014089 missense probably damaging 1.00
R3774:Crispld2 UTSW 8 120029266 missense probably damaging 0.99
R6044:Crispld2 UTSW 8 120010671 missense possibly damaging 0.66
R6485:Crispld2 UTSW 8 120029309 missense probably damaging 0.99
R6861:Crispld2 UTSW 8 120026113 missense probably damaging 1.00
R7792:Crispld2 UTSW 8 120031070 missense probably benign 0.01
R8814:Crispld2 UTSW 8 120015345 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CCAGGATGAGTTCTTAAGCCATC -3'
(R):5'- CCACTTCTACAATAAGAAAACAGTGAT -3'

Sequencing Primer
(F):5'- TTCTTAAGCCATCCAGGAAAAGG -3'
(R):5'- TCCCAGCAATCATATGGGTG -3'
Posted On2015-03-25