Incidental Mutation 'R4174:Pde12'
ID318243
Institutional Source Beutler Lab
Gene Symbol Pde12
Ensembl Gene ENSMUSG00000043702
Gene Namephosphodiesterase 12
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4174 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location26659958-26669883 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 26668989 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 188 (D188E)
Ref Sequence ENSEMBL: ENSMUSP00000059666 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052932]
Predicted Effect probably benign
Transcript: ENSMUST00000052932
AA Change: D188E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000059666
Gene: ENSMUSG00000043702
AA Change: D188E

DomainStartEndE-ValueType
low complexity region 13 25 N/A INTRINSIC
low complexity region 210 223 N/A INTRINSIC
Pfam:Exo_endo_phos 297 598 1.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167376
SMART Domains Protein: ENSMUSP00000127272
Gene: ENSMUSG00000021877

DomainStartEndE-ValueType
Pfam:Arf 1 60 4.2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184349
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 T C 1: 38,207,927 H859R probably damaging Het
Agap2 T C 10: 127,090,514 V876A probably damaging Het
Akip1 C T 7: 109,707,509 Q138* probably null Het
Cep70 T C 9: 99,246,313 probably benign Het
Ddx23 G A 15: 98,658,251 S62F unknown Het
Gabrp A G 11: 33,568,092 I72T probably damaging Het
Gpsm2 C T 3: 108,702,509 A102T probably damaging Het
Metap2 A G 10: 93,879,565 C112R possibly damaging Het
Olfr48 T G 2: 89,844,778 D65A probably damaging Het
Olfr901 T A 9: 38,431,020 I246K probably damaging Het
Pirb A T 7: 3,716,032 probably null Het
Rreb1 T A 13: 37,930,150 L495Q possibly damaging Het
Slc12a5 T C 2: 164,979,490 I275T probably damaging Het
Tas2r122 A G 6: 132,711,876 I18T probably damaging Het
Tdrkh A G 3: 94,428,233 T378A possibly damaging Het
Ubr1 C T 2: 120,946,622 probably null Het
Zglp1 A G 9: 21,066,070 F150L possibly damaging Het
Other mutations in Pde12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02085:Pde12 APN 14 26666464 unclassified probably benign
IGL02306:Pde12 APN 14 26668378 missense possibly damaging 0.83
IGL02630:Pde12 APN 14 26666397 missense probably damaging 1.00
IGL02830:Pde12 APN 14 26668585 missense probably damaging 1.00
IGL03268:Pde12 APN 14 26668459 missense probably benign 0.32
R1727:Pde12 UTSW 14 26668867 missense probably benign 0.02
R2057:Pde12 UTSW 14 26668880 missense probably benign
R2059:Pde12 UTSW 14 26668880 missense probably benign
R2510:Pde12 UTSW 14 26665526 makesense probably null
R5121:Pde12 UTSW 14 26669422 nonsense probably null
R5190:Pde12 UTSW 14 26666377 critical splice donor site probably null
R5387:Pde12 UTSW 14 26666453 missense probably benign 0.00
R5847:Pde12 UTSW 14 26665631 missense possibly damaging 0.96
R5987:Pde12 UTSW 14 26669098 missense probably benign 0.02
R7495:Pde12 UTSW 14 26668839 missense probably benign 0.19
R8021:Pde12 UTSW 14 26665699 nonsense probably null
R8865:Pde12 UTSW 14 26669125 missense possibly damaging 0.51
R8898:Pde12 UTSW 14 26669422 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- ATTGCCCGGTGTACAGTGAAG -3'
(R):5'- GGTGGTGAAGCTGTACTACC -3'

Sequencing Primer
(F):5'- TGTACAGTGAAGCCGGAGCC -3'
(R):5'- TGAAGCTGTACTACCGGGAG -3'
Posted On2015-06-10