Incidental Mutation 'R4741:Ighg1'
ID358097
Institutional Source Beutler Lab
Gene Symbol Ighg1
Ensembl Gene ENSMUSG00000076614
Gene Nameimmunoglobulin heavy constant gamma 1 (G1m marker)
SynonymsIgh-4, IgG1
MMRRC Submission 042026-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4741 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location113325240-113330523 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 113326558 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect probably benign
Transcript: ENSMUST00000103420
SMART Domains Protein: ENSMUSP00000100216
Gene: ENSMUSG00000076614

DomainStartEndE-ValueType
IGc1 22 92 3.64e-15 SMART
Pfam:C1-set 124 210 2e-14 PFAM
IGc1 239 312 4.57e-39 SMART
Predicted Effect unknown
Transcript: ENSMUST00000194304
AA Change: I388V
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutant mice are viable and fertile but show impaired primary and secondary Igh-4 immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,942,375 T1079A probably damaging Het
Angptl2 T C 2: 33,246,188 Y462H probably benign Het
Arhgef12 A G 9: 42,972,153 I1360T possibly damaging Het
Armc10 T G 5: 21,651,836 L111R probably damaging Het
Atm T C 9: 53,453,607 K2628E probably benign Het
Best3 A T 10: 117,023,996 N387I probably benign Het
Brpf3 T C 17: 28,817,784 F721S possibly damaging Het
Cacna1c A G 6: 118,613,310 S1411P probably damaging Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Clip2 T A 5: 134,516,269 T344S probably benign Het
Csmd1 A C 8: 15,910,447 W3323G probably damaging Het
Doc2a A T 7: 126,851,445 T298S possibly damaging Het
Dpp9 T C 17: 56,205,286 N234S probably benign Het
Dtx2 C T 5: 136,026,517 R353C probably benign Het
Epm2aip1 A G 9: 111,272,613 H218R probably benign Het
F2rl1 G A 13: 95,514,143 T77M probably damaging Het
Fsd2 A G 7: 81,551,895 probably null Het
Grin2a T C 16: 9,663,512 Y475C probably damaging Het
H2-Ob T A 17: 34,242,571 S95T possibly damaging Het
Hddc3 A G 7: 80,345,716 T160A probably benign Het
Hp A T 8: 109,575,472 C281* probably null Het
Ints7 A G 1: 191,619,635 I819V probably benign Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Jmjd1c A G 10: 67,224,939 I737V possibly damaging Het
Krt74 C T 15: 101,761,441 noncoding transcript Het
Lnpep T C 17: 17,571,658 Y407C probably damaging Het
Lrp4 T G 2: 91,511,567 C1842G probably damaging Het
Mug2 T A 6: 122,079,613 N1172K probably benign Het
Npy6r A T 18: 44,275,724 T71S probably damaging Het
Nsd3 A T 8: 25,673,366 I591F probably damaging Het
Oog2 A C 4: 144,195,145 E208D possibly damaging Het
Otogl A G 10: 107,779,260 I1928T probably benign Het
Papss1 T C 3: 131,619,099 L418P probably damaging Het
Pcdhb13 T A 18: 37,443,518 D316E probably benign Het
Pcdhgb2 T A 18: 37,691,684 probably null Het
Ptcd3 T A 6: 71,902,949 L108F probably damaging Het
Ralgps1 T C 2: 33,336,587 S31G probably benign Het
Rnf225 A T 7: 12,927,930 H12L probably benign Het
Ryr3 T A 2: 112,803,268 M2047L probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpinb3b G T 1: 107,154,470 Q355K probably benign Het
Slc8a2 T A 7: 16,134,308 F155Y probably damaging Het
Taf1c A G 8: 119,603,395 probably benign Het
Tln2 A G 9: 67,386,555 probably null Het
Tmpo A G 10: 91,162,644 V427A probably benign Het
Vmn1r17 A T 6: 57,361,352 Y9* probably null Het
Vmn2r63 C T 7: 42,928,120 M331I probably benign Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfand5 C T 19: 21,276,481 T16I probably damaging Het
Zfp352 A T 4: 90,224,940 K439M possibly damaging Het
Zfp786 G A 6: 47,820,691 H438Y probably damaging Het
Zfp808 T A 13: 62,171,949 C331S probably damaging Het
Other mutations in Ighg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Ighg1 APN 12 113329184 missense unknown
IGL02637:Ighg1 APN 12 113329512 missense unknown
Gee UTSW 12 113330506 missense unknown
whiz UTSW 12 113330446 missense
R3436:Ighg1 UTSW 12 113329560 missense probably damaging 0.97
R4012:Ighg1 UTSW 12 113329650 missense probably damaging 1.00
R4883:Ighg1 UTSW 12 113327518 unclassified probably benign
R5450:Ighg1 UTSW 12 113330506 missense unknown
R5642:Ighg1 UTSW 12 113329034 missense probably damaging 0.97
R7219:Ighg1 UTSW 12 113326596 missense
R7243:Ighg1 UTSW 12 113330446 missense
R7313:Ighg1 UTSW 12 113329458 missense
R7534:Ighg1 UTSW 12 113329729 missense
R8029:Ighg1 UTSW 12 113329145 missense
Predicted Primers PCR Primer
(F):5'- ACATGGTCCTTCAGAGAGGG -3'
(R):5'- AGTGTCCAATGATCTACCCCAC -3'

Sequencing Primer
(F):5'- TGGTCCTTCAGAGAGGGAAAATTTG -3'
(R):5'- CACTCCTGCACAGCTGG -3'
Posted On2015-11-11