Incidental Mutation 'R5018:Sh3gl2'
ID389046
Institutional Source Beutler Lab
Gene Symbol Sh3gl2
Ensembl Gene ENSMUSG00000028488
Gene NameSH3-domain GRB2-like 2
SynonymsB930049H17Rik, endophilin A1, 9530001L19Rik, endophilin I, Sh3d2a, EEN-B1
MMRRC Submission 042609-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5018 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location85205126-85639195 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 85391054 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000030212] [ENSMUST00000107188] [ENSMUST00000107189]
Predicted Effect probably benign
Transcript: ENSMUST00000030212
SMART Domains Protein: ENSMUSP00000030212
Gene: ENSMUSG00000028488

DomainStartEndE-ValueType
BAR 5 242 2.13e-94 SMART
SH3 293 348 3.19e-24 SMART
Predicted Effect unknown
Transcript: ENSMUST00000107188
AA Change: E339G
SMART Domains Protein: ENSMUSP00000102806
Gene: ENSMUSG00000028488
AA Change: E339G

DomainStartEndE-ValueType
BAR 5 242 2.13e-94 SMART
SH3 293 351 4.78e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107189
SMART Domains Protein: ENSMUSP00000102807
Gene: ENSMUSG00000028488

DomainStartEndE-ValueType
BAR 5 242 2.13e-94 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133109
SMART Domains Protein: ENSMUSP00000117573
Gene: ENSMUSG00000028488

DomainStartEndE-ValueType
BAR 1 180 3.83e-37 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 98% (49/50)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are normal and fertile. Mice homozygous for knock-out alleles of Sh3gl1-3 exhibit neonatal lethality, respiratory distress, absence of gastric milk, abnormal synaptic transmission and abnormal synaptic vesicle recycling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A T 14: 68,571,779 F245I probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Als2cr12 A G 1: 58,690,950 V67A probably benign Het
Alx4 G T 2: 93,677,419 G353V probably damaging Het
Apol7b A G 15: 77,424,716 F61L probably benign Het
Aunip T A 4: 134,523,617 probably null Het
Bfsp1 C A 2: 143,862,882 R17L possibly damaging Het
Birc6 T A 17: 74,640,059 D2926E probably damaging Het
Dmwd A G 7: 19,078,119 D166G probably damaging Het
Dnah10 T C 5: 124,762,196 S1233P possibly damaging Het
Dnah11 G T 12: 118,130,728 N868K probably benign Het
Eea1 T C 10: 96,011,037 V393A probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fyttd1 A G 16: 32,902,417 probably null Het
Hal T C 10: 93,507,551 probably null Het
Hhat A T 1: 192,595,038 L371Q probably damaging Het
Hpse2 A G 19: 43,384,824 F122S possibly damaging Het
Kif21b A G 1: 136,172,234 I1509V probably benign Het
Klhl20 T C 1: 161,101,586 D334G probably damaging Het
Macf1 C T 4: 123,385,599 D3870N probably damaging Het
Nlrc5 C T 8: 94,525,452 A1867V probably damaging Het
Nr1h5 A G 3: 102,947,795 L330P probably damaging Het
Olfr1513 A C 14: 52,349,279 C256G possibly damaging Het
Pcdh15 T G 10: 74,643,775 S573A possibly damaging Het
Polr1c G T 17: 46,247,709 probably benign Het
Scd4 T A 19: 44,337,609 M134K probably benign Het
Sin3a T A 9: 57,110,891 S865T probably benign Het
Slitrk3 G A 3: 73,050,512 T309I probably benign Het
Sspo G A 6: 48,455,700 E837K probably damaging Het
Stag1 A G 9: 100,951,619 D1095G probably benign Het
Trat1 A T 16: 48,734,805 L188* probably null Het
Ubn1 A G 16: 5,063,725 D207G probably damaging Het
Ugp2 A G 11: 21,331,052 Y219H probably damaging Het
Ugt2b1 G T 5: 86,925,962 Y179* probably null Het
Vmn2r27 T A 6: 124,224,182 D272V probably benign Het
Vmn2r3 T C 3: 64,271,353 E497G probably benign Het
Vmn2r91 G T 17: 18,136,438 C789F probably damaging Het
Zfp276 A G 8: 123,264,977 probably benign Het
Other mutations in Sh3gl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Sh3gl2 APN 4 85347196 splice site probably benign
PIT4362001:Sh3gl2 UTSW 4 85377549 missense probably benign 0.00
R0699:Sh3gl2 UTSW 4 85347171 missense probably benign 0.00
R0960:Sh3gl2 UTSW 4 85377480 missense probably damaging 1.00
R1562:Sh3gl2 UTSW 4 85385893 missense probably benign 0.00
R3877:Sh3gl2 UTSW 4 85379381 missense possibly damaging 0.92
R4466:Sh3gl2 UTSW 4 85381451 missense possibly damaging 0.62
R4630:Sh3gl2 UTSW 4 85379409 missense probably damaging 1.00
R4811:Sh3gl2 UTSW 4 85398166 intron probably benign
R4888:Sh3gl2 UTSW 4 85379257 missense probably benign 0.17
R5121:Sh3gl2 UTSW 4 85379257 missense probably benign 0.17
R5285:Sh3gl2 UTSW 4 85376449 missense probably benign 0.03
R5484:Sh3gl2 UTSW 4 85398923 intron probably benign
R5611:Sh3gl2 UTSW 4 85355331 missense probably benign 0.39
R6029:Sh3gl2 UTSW 4 85381414 missense probably damaging 0.97
R7048:Sh3gl2 UTSW 4 85377565 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCAAGTCAGTCTGTCAGTC -3'
(R):5'- AAGTCTGTGGTATCATTGCAGG -3'

Sequencing Primer
(F):5'- AGTAGGTGGTATCTCCCCTAACAG -3'
(R):5'- GAGGGTGGAAATACATTTGTAAAATC -3'
Posted On2016-06-06