Incidental Mutation 'R5018:Alx4'
ID389042
Institutional Source Beutler Lab
Gene Symbol Alx4
Ensembl Gene ENSMUSG00000040310
Gene Namearistaless-like homeobox 4
SynonymsAristaless-like 4
MMRRC Submission 042609-MU
Accession Numbers

Genbank: NM_007442; MGI: 108359

Is this an essential gene? Possibly essential (E-score: 0.557) question?
Stock #R5018 (G1)
Quality Score189
Status Validated
Chromosome2
Chromosomal Location93642384-93681339 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 93677419 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 353 (G353V)
Ref Sequence ENSEMBL: ENSMUSP00000047962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042078] [ENSMUST00000111254] [ENSMUST00000184931]
Predicted Effect probably damaging
Transcript: ENSMUST00000042078
AA Change: G353V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047962
Gene: ENSMUSG00000040310
AA Change: G353V

DomainStartEndE-ValueType
low complexity region 91 108 N/A INTRINSIC
HOX 202 264 1.11e-28 SMART
low complexity region 302 319 N/A INTRINSIC
Pfam:OAR 375 393 1.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111254
SMART Domains Protein: ENSMUSP00000106885
Gene: ENSMUSG00000040310

DomainStartEndE-ValueType
low complexity region 91 108 N/A INTRINSIC
HOX 202 264 1.11e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184931
SMART Domains Protein: ENSMUSP00000138956
Gene: ENSMUSG00000027198

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
Pfam:Exostosin 100 380 1.4e-57 PFAM
Pfam:Glyco_transf_64 456 559 9.5e-31 PFAM
Meta Mutation Damage Score 0.2430 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a paired-like homeodomain transcription factor expressed in the mesenchyme of developing bones, limbs, hair, teeth, and mammary tissue. Mutations in this gene cause parietal foramina 2 (PFM2); an autosomal dominant disease characterized by deficient ossification of the parietal bones. Mutations in this gene also cause a form of frontonasal dysplasia with alopecia and hypogonadism; suggesting a role for this gene in craniofacial development, mesenchymal-epithelial communication, and hair follicle development. Deletion of a segment of chromosome 11 containing this gene, del(11)(p11p12), causes Potocki-Shaffer syndrome (PSS); a syndrome characterized by craniofacial anomalies, mental retardation, multiple exostoses, and genital abnormalities in males. In mouse, this gene has been shown to use dual translation initiation sites located 16 codons apart. [provided by RefSeq, Oct 2009]
PHENOTYPE: Depending on genetic background mutant mice may show preaxial polydactyly and other skeletal alterations, transitory alopecia, ventral body wall defects and male sterility. Homozygous mice of one allele die prenatally. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Spontaneous(1) Chemically induced(3)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A T 14: 68,571,779 F245I probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Als2cr12 A G 1: 58,690,950 V67A probably benign Het
Apol7b A G 15: 77,424,716 F61L probably benign Het
Aunip T A 4: 134,523,617 probably null Het
Bfsp1 C A 2: 143,862,882 R17L possibly damaging Het
Birc6 T A 17: 74,640,059 D2926E probably damaging Het
Dmwd A G 7: 19,078,119 D166G probably damaging Het
Dnah10 T C 5: 124,762,196 S1233P possibly damaging Het
Dnah11 G T 12: 118,130,728 N868K probably benign Het
Eea1 T C 10: 96,011,037 V393A probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fyttd1 A G 16: 32,902,417 probably null Het
Hal T C 10: 93,507,551 probably null Het
Hhat A T 1: 192,595,038 L371Q probably damaging Het
Hpse2 A G 19: 43,384,824 F122S possibly damaging Het
Kif21b A G 1: 136,172,234 I1509V probably benign Het
Klhl20 T C 1: 161,101,586 D334G probably damaging Het
Macf1 C T 4: 123,385,599 D3870N probably damaging Het
Nlrc5 C T 8: 94,525,452 A1867V probably damaging Het
Nr1h5 A G 3: 102,947,795 L330P probably damaging Het
Olfr1513 A C 14: 52,349,279 C256G possibly damaging Het
Pcdh15 T G 10: 74,643,775 S573A possibly damaging Het
Polr1c G T 17: 46,247,709 probably benign Het
Scd4 T A 19: 44,337,609 M134K probably benign Het
Sh3gl2 A G 4: 85,391,054 probably benign Het
Sin3a T A 9: 57,110,891 S865T probably benign Het
Slitrk3 G A 3: 73,050,512 T309I probably benign Het
Sspo G A 6: 48,455,700 E837K probably damaging Het
Stag1 A G 9: 100,951,619 D1095G probably benign Het
Trat1 A T 16: 48,734,805 L188* probably null Het
Ubn1 A G 16: 5,063,725 D207G probably damaging Het
Ugp2 A G 11: 21,331,052 Y219H probably damaging Het
Ugt2b1 G T 5: 86,925,962 Y179* probably null Het
Vmn2r27 T A 6: 124,224,182 D272V probably benign Het
Vmn2r3 T C 3: 64,271,353 E497G probably benign Het
Vmn2r91 G T 17: 18,136,438 C789F probably damaging Het
Zfp276 A G 8: 123,264,977 probably benign Het
Other mutations in Alx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01872:Alx4 APN 2 93677473 missense probably benign 0.10
goofy UTSW 2 93675369 missense probably damaging 1.00
PIT4519001:Alx4 UTSW 2 93675428 missense probably benign 0.00
R0367:Alx4 UTSW 2 93668608 missense probably damaging 1.00
R0436:Alx4 UTSW 2 93668357 nonsense probably null
R0864:Alx4 UTSW 2 93642855 missense probably damaging 1.00
R1913:Alx4 UTSW 2 93675387 missense probably damaging 1.00
R3712:Alx4 UTSW 2 93642789 missense possibly damaging 0.87
R4619:Alx4 UTSW 2 93642761 missense probably damaging 1.00
R5227:Alx4 UTSW 2 93677380 missense probably damaging 1.00
R6505:Alx4 UTSW 2 93668559 missense probably damaging 1.00
R7173:Alx4 UTSW 2 93642857 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AGCTGGCCTATGACATCTCTC -3'
(R):5'- GGGATGACATCAGGAGTTGC -3'

Sequencing Primer
(F):5'- GATTCAGAACCCATCCTGGATTGG -3'
(R):5'- TGACATCAGGAGTTGCAGGAG -3'
Posted On2016-06-06