Incidental Mutation 'R0441:Olfr1019'
ID39137
Institutional Source Beutler Lab
Gene Symbol Olfr1019
Ensembl Gene ENSMUSG00000075208
Gene Nameolfactory receptor 1019
SynonymsMOR180-1, GA_x6K02T2Q125-47320309-47319377
MMRRC Submission 038642-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R0441 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location85839621-85845483 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85841515 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 92 (I92N)
Ref Sequence ENSEMBL: ENSMUSP00000150622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102634] [ENSMUST00000213515]
Predicted Effect probably damaging
Transcript: ENSMUST00000102634
AA Change: I92N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099694
Gene: ENSMUSG00000075208
AA Change: I92N

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.7e-55 PFAM
Pfam:7TM_GPCR_Srsx 35 237 1.6e-6 PFAM
Pfam:7tm_1 41 290 1.4e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213515
AA Change: I92N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.1807 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T C 4: 103,235,492 probably benign Het
Adgrv1 G A 13: 81,397,226 R5647* probably null Het
Agbl2 C T 2: 90,797,483 R211* probably null Het
Akap9 A G 5: 3,961,714 K806E probably benign Het
Ampd1 C G 3: 103,088,478 L235V probably benign Het
Atcay T C 10: 81,224,460 D14G possibly damaging Het
Atp8b4 C T 2: 126,378,706 probably benign Het
Bmp8b T C 4: 123,124,515 V393A probably damaging Het
Brca2 T A 5: 150,541,857 D1695E probably damaging Het
Cdh15 A G 8: 122,860,966 I210V probably damaging Het
Cep250 T C 2: 155,972,004 L564P possibly damaging Het
Cmpk1 T C 4: 114,965,023 T110A probably benign Het
Cpsf3 T G 12: 21,300,084 I268S probably damaging Het
Csmd2 C T 4: 128,520,230 A2621V probably benign Het
Cyp2c40 T C 19: 39,807,163 probably benign Het
D430041D05Rik T A 2: 104,167,947 Y1837F probably damaging Het
Degs2 A G 12: 108,702,214 F10S probably damaging Het
Dytn T A 1: 63,678,774 probably benign Het
Elfn2 G C 15: 78,673,595 P251A probably benign Het
Epg5 T C 18: 78,023,271 probably benign Het
Evc2 A G 5: 37,417,467 D1022G probably damaging Het
Fat3 A G 9: 15,945,008 probably benign Het
Fbn1 A T 2: 125,309,755 probably null Het
Gm15217 T C 14: 46,383,219 probably null Het
Gm17611 A T 13: 49,976,399 noncoding transcript Het
Gpld1 G A 13: 24,962,320 W182* probably null Het
Gsc T C 12: 104,473,094 I8V probably damaging Het
Hck A G 2: 153,134,132 K197R probably benign Het
Kat6b T C 14: 21,670,233 L1551P probably damaging Het
Lrch1 C T 14: 74,947,545 G39D possibly damaging Het
Macf1 T C 4: 123,365,355 probably null Het
Mroh9 A T 1: 163,060,762 V248E probably damaging Het
Mrps15 C A 4: 126,051,417 probably benign Het
Mum1 A T 10: 80,229,025 N30Y probably damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Ndufa5 T C 6: 24,522,751 T31A probably benign Het
Nfyb A G 10: 82,750,760 V190A possibly damaging Het
Nos2 A G 11: 78,928,583 I40M probably benign Het
Olfr1084 A T 2: 86,639,330 I126K probably damaging Het
Olfr452 T C 6: 42,790,174 I45T probably damaging Het
Otog T C 7: 46,305,877 S564P probably damaging Het
Pak7 C T 2: 136,116,629 A180T probably benign Het
Pappa2 T C 1: 158,763,058 probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plxnc1 T A 10: 94,796,482 N1431I probably damaging Het
Prph A T 15: 99,057,438 I429L probably damaging Het
Prrc2a A G 17: 35,149,688 probably benign Het
Rad54b A T 4: 11,563,394 T18S probably benign Het
Ranbp2 A G 10: 58,485,768 E2629G probably benign Het
Rec114 G A 9: 58,657,770 T201I probably benign Het
Rspo1 G A 4: 124,991,397 R22Q probably benign Het
Sec23b A G 2: 144,581,997 E522G probably damaging Het
Sgsm3 G A 15: 81,009,770 R502H possibly damaging Het
Sh3pxd2b C A 11: 32,423,023 A730D possibly damaging Het
Spag4 A G 2: 156,067,979 D187G probably damaging Het
Srgap2 G A 1: 131,336,437 T465I probably damaging Het
St3gal6 C A 16: 58,473,453 A238S probably damaging Het
St3gal6 G T 16: 58,473,455 A237E probably damaging Het
Tecpr1 C A 5: 144,195,941 R1159L probably benign Het
Tmem63b A T 17: 45,666,315 probably null Het
Tmtc1 T A 6: 148,415,758 D78V probably damaging Het
Tpp2 A G 1: 43,990,562 N68D possibly damaging Het
Ttn C A 2: 76,939,925 A2641S probably benign Het
Uimc1 T C 13: 55,093,219 K19E probably damaging Het
Utrn T A 10: 12,688,294 E1274V probably null Het
Vmn2r102 A T 17: 19,694,368 I732F probably damaging Het
Wrn A T 8: 33,268,750 M792K probably benign Het
Zfp451 A G 1: 33,777,045 I608T probably damaging Het
Other mutations in Olfr1019
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Olfr1019 APN 2 85841362 missense probably benign 0.02
IGL02734:Olfr1019 APN 2 85841539 missense possibly damaging 0.88
IGL03030:Olfr1019 APN 2 85841072 missense probably damaging 1.00
IGL03207:Olfr1019 APN 2 85840973 missense probably benign 0.14
IGL03215:Olfr1019 APN 2 85841381 missense probably damaging 1.00
IGL03220:Olfr1019 APN 2 85840982 missense possibly damaging 0.87
R4013:Olfr1019 UTSW 2 85841381 missense probably damaging 1.00
R4604:Olfr1019 UTSW 2 85841182 missense probably damaging 0.99
R5307:Olfr1019 UTSW 2 85841014 missense probably damaging 1.00
R5754:Olfr1019 UTSW 2 85841312 missense probably damaging 1.00
R6010:Olfr1019 UTSW 2 85841561 missense probably benign 0.16
R6062:Olfr1019 UTSW 2 85841114 missense probably benign
R6103:Olfr1019 UTSW 2 85841432 missense probably damaging 1.00
R6443:Olfr1019 UTSW 2 85841635 missense probably damaging 0.99
R7442:Olfr1019 UTSW 2 85841752 missense probably benign 0.04
R7490:Olfr1019 UTSW 2 85840963 missense probably damaging 1.00
R7524:Olfr1019 UTSW 2 85841357 missense probably benign
R7605:Olfr1019 UTSW 2 85841039 missense probably benign 0.34
R7615:Olfr1019 UTSW 2 85841657 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GTAAGAGCCCAGCATTAGGACCAAG -3'
(R):5'- TGGGCATAACTCAAGACCCTCAGC -3'

Sequencing Primer
(F):5'- CAAGCAGACTTTCTTGGACATGAG -3'
(R):5'- CTCCTTGTCTACCTGGTCAATGTG -3'
Posted On2013-05-23