Incidental Mutation 'R3124:Iglc3'
List |< first << previous [record 15 of 38] next >> last >|
ID477975
Institutional Source Beutler Lab
Gene Symbol Iglc3
Ensembl Gene ENSMUSG00000105547
Gene Nameimmunoglobulin lambda constant 3
Synonyms
MMRRC Submission 040597-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R3124 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location19065365-19065681 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 19065595 bp
ZygosityHeterozygous
Amino Acid Change
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198927
Predicted Effect probably benign
Transcript: ENSMUST00000199490
Predicted Effect probably benign
Transcript: ENSMUST00000200074
Predicted Effect probably benign
Transcript: ENSMUST00000200211
Predicted Effect unknown
Transcript: ENSMUST00000200235
AA Change: I29V
Predicted Effect probably benign
Transcript: ENSMUST00000200568
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd16b G A 2: 181,494,526 R407H possibly damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Cadm1 A G 9: 47,799,477 E226G possibly damaging Het
Caskin2 T C 11: 115,804,797 D246G probably damaging Het
Cd80 T A 16: 38,473,893 V46E probably damaging Het
Ctr9 C T 7: 111,053,446 R984C unknown Het
Dach2 T C X: 113,819,967 I417T possibly damaging Het
Drd3 T C 16: 43,822,792 F464L probably damaging Het
Dyrk1a G A 16: 94,668,801 probably benign Het
Fam227b T C 2: 126,124,086 T140A probably benign Het
Fam91a1 A G 15: 58,421,889 I101V probably benign Het
Fem1b T C 9: 62,796,554 I475V probably benign Het
Glra3 A G 8: 56,125,209 R434G possibly damaging Het
Hsd17b12 C T 2: 94,033,958 R268Q probably benign Het
Khdrbs2 C A 1: 32,519,777 R408L probably damaging Het
Loxhd1 A G 18: 77,431,078 D1860G probably damaging Het
Mcpt8 A T 14: 56,083,941 I22K probably damaging Het
Myo1h A G 5: 114,328,799 I303V probably benign Het
Nipsnap2 G A 5: 129,748,034 probably null Het
Nop2 G A 6: 125,132,201 probably benign Het
Pet2 A T X: 89,404,721 Y601N probably benign Het
Polr2a A T 11: 69,735,710 S1566T possibly damaging Het
Pthlh A T 6: 147,263,291 V27E probably damaging Het
Ralgps1 T C 2: 33,158,956 T314A possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Skil A G 3: 31,097,338 N3S probably benign Het
Tas2r129 A G 6: 132,951,448 N116S probably damaging Het
Tas2r140 T A 6: 133,055,241 I185L probably benign Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Togaram1 G T 12: 64,966,344 R123L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim12a G T 7: 104,300,856 T292K probably benign Het
Trim9 C T 12: 70,248,393 G648R probably damaging Het
Trmt13 T C 3: 116,590,244 I104V probably benign Het
Vav3 G A 3: 109,628,168 probably null Het
Vmn1r87 A G 7: 13,131,566 Y265H probably damaging Het
Zfp574 G T 7: 25,081,601 A683S possibly damaging Het
Other mutations in Iglc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R5652:Iglc3 UTSW 16 19065670 unclassified probably benign
R6890:Iglc3 UTSW 16 19065508 unclassified probably benign
R7247:Iglc3 UTSW 16 19065441 missense
R7863:Iglc3 UTSW 16 19065498 missense not run
R7946:Iglc3 UTSW 16 19065498 missense not run
Predicted Primers
Posted On2017-05-15