Incidental Mutation 'R3124:Hsd17b12'
ID264184
Institutional Source Beutler Lab
Gene Symbol Hsd17b12
Ensembl Gene ENSMUSG00000027195
Gene Namehydroxysteroid (17-beta) dehydrogenase 12
Synonymskeratonectin, keratoadhesin, 2610510O05Rik, KIK-I
MMRRC Submission 040597-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3124 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location94032689-94157964 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 94033958 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 268 (R268Q)
Ref Sequence ENSEMBL: ENSMUSP00000028619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028619]
Predicted Effect probably benign
Transcript: ENSMUST00000028619
AA Change: R268Q

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000028619
Gene: ENSMUSG00000027195
AA Change: R268Q

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
Pfam:adh_short 51 248 1.5e-46 PFAM
Pfam:KR 52 125 4.4e-7 PFAM
Pfam:adh_short_C2 57 277 7.5e-10 PFAM
low complexity region 298 312 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146580
Meta Mutation Damage Score 0.0598 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a very important 17beta-hydroxysteroid dehydrogenase (17beta-HSD) that converts estrone into estradiol in ovarian tissue. This enzyme is also involved in fatty acid elongation. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit die around E8.5 with abnormal embryonic and extraembryonic tissue development. ES cells heterozygous for this allele exhibit reduced arachidonic acid levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd16b G A 2: 181,494,526 R407H possibly damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Cadm1 A G 9: 47,799,477 E226G possibly damaging Het
Caskin2 T C 11: 115,804,797 D246G probably damaging Het
Cd80 T A 16: 38,473,893 V46E probably damaging Het
Ctr9 C T 7: 111,053,446 R984C unknown Het
Dach2 T C X: 113,819,967 I417T possibly damaging Het
Drd3 T C 16: 43,822,792 F464L probably damaging Het
Dyrk1a G A 16: 94,668,801 probably benign Het
Fam227b T C 2: 126,124,086 T140A probably benign Het
Fam91a1 A G 15: 58,421,889 I101V probably benign Het
Fem1b T C 9: 62,796,554 I475V probably benign Het
Glra3 A G 8: 56,125,209 R434G possibly damaging Het
Iglc3 T C 16: 19,065,595 probably benign Het
Khdrbs2 C A 1: 32,519,777 R408L probably damaging Het
Loxhd1 A G 18: 77,431,078 D1860G probably damaging Het
Mcpt8 A T 14: 56,083,941 I22K probably damaging Het
Myo1h A G 5: 114,328,799 I303V probably benign Het
Nipsnap2 G A 5: 129,748,034 probably null Het
Nop2 G A 6: 125,132,201 probably benign Het
Pet2 A T X: 89,404,721 Y601N probably benign Het
Polr2a A T 11: 69,735,710 S1566T possibly damaging Het
Pthlh A T 6: 147,263,291 V27E probably damaging Het
Ralgps1 T C 2: 33,158,956 T314A possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Skil A G 3: 31,097,338 N3S probably benign Het
Tas2r129 A G 6: 132,951,448 N116S probably damaging Het
Tas2r140 T A 6: 133,055,241 I185L probably benign Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Togaram1 G T 12: 64,966,344 R123L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim12a G T 7: 104,300,856 T292K probably benign Het
Trim9 C T 12: 70,248,393 G648R probably damaging Het
Trmt13 T C 3: 116,590,244 I104V probably benign Het
Vav3 G A 3: 109,628,168 probably null Het
Vmn1r87 A G 7: 13,131,566 Y265H probably damaging Het
Zfp574 G T 7: 25,081,601 A683S possibly damaging Het
Other mutations in Hsd17b12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Hsd17b12 APN 2 94083165 critical splice donor site probably null
IGL00785:Hsd17b12 APN 2 94045414 missense probably damaging 1.00
IGL02230:Hsd17b12 APN 2 94045398 missense possibly damaging 0.94
IGL02635:Hsd17b12 APN 2 94083211 missense possibly damaging 0.93
IGL03094:Hsd17b12 APN 2 94033994 missense probably damaging 1.00
R0242:Hsd17b12 UTSW 2 94157815 missense probably benign 0.14
R0242:Hsd17b12 UTSW 2 94157815 missense probably benign 0.14
R0390:Hsd17b12 UTSW 2 94114990 splice site probably benign
R0552:Hsd17b12 UTSW 2 94043935 missense probably damaging 1.00
R0605:Hsd17b12 UTSW 2 94033642 missense probably benign 0.00
R1585:Hsd17b12 UTSW 2 94033976 missense probably damaging 1.00
R1681:Hsd17b12 UTSW 2 94033561 missense unknown
R1922:Hsd17b12 UTSW 2 94045392 missense probably benign 0.00
R2190:Hsd17b12 UTSW 2 94034063 missense probably benign 0.02
R2384:Hsd17b12 UTSW 2 94033619 missense probably benign
R3123:Hsd17b12 UTSW 2 94033958 missense probably benign 0.03
R3125:Hsd17b12 UTSW 2 94033958 missense probably benign 0.03
R4283:Hsd17b12 UTSW 2 94033586 missense unknown
R5218:Hsd17b12 UTSW 2 94083263 missense probably benign 0.02
R5357:Hsd17b12 UTSW 2 94033645 missense possibly damaging 0.47
R6020:Hsd17b12 UTSW 2 94033977 missense probably damaging 1.00
R6493:Hsd17b12 UTSW 2 94043883 missense probably damaging 1.00
R7792:Hsd17b12 UTSW 2 94033641 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAAAAGCCTATCTGCCACCTTC -3'
(R):5'- CTTCCTAATCAATGGCATGTGTTG -3'

Sequencing Primer
(F):5'- AAAGCCTATCTGCCACCTTCTAATTC -3'
(R):5'- AATCAATGGCATGTGTTGTCTTTTC -3'
Posted On2015-02-05