Incidental Mutation 'R6300:Sfrp4'
ID509060
Institutional Source Beutler Lab
Gene Symbol Sfrp4
Ensembl Gene ENSMUSG00000021319
Gene Namesecreted frizzled-related protein 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.270) question?
Stock #R6300 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location19623104-19632994 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 19623853 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 141 (A141T)
Ref Sequence ENSEMBL: ENSMUSP00000152498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002883] [ENSMUST00000002885] [ENSMUST00000220944] [ENSMUST00000221014] [ENSMUST00000222464] [ENSMUST00000222992]
Predicted Effect probably damaging
Transcript: ENSMUST00000002883
AA Change: A141T

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000002883
Gene: ENSMUSG00000021319
AA Change: A141T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FRI 23 141 1.8e-60 SMART
C345C 187 290 2.7e-27 SMART
low complexity region 306 314 N/A INTRINSIC
low complexity region 316 333 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000002885
SMART Domains Protein: ENSMUSP00000002885
Gene: ENSMUSG00000002808

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Ependymin 87 210 1e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220755
Predicted Effect probably benign
Transcript: ENSMUST00000220944
Predicted Effect probably benign
Transcript: ENSMUST00000221014
Predicted Effect unknown
Transcript: ENSMUST00000221810
AA Change: A14T
Predicted Effect probably damaging
Transcript: ENSMUST00000222464
AA Change: A141T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000222992
Meta Mutation Damage Score 0.4979 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Secreted frizzled-related protein 4 (SFRP4) is a member of the SFRP family that contains a cysteine-rich domain homologous to the putative Wnt-binding site of Frizzled proteins. SFRPs act as soluble modulators of Wnt signaling. The expression of SFRP4 in ventricular myocardium correlates with apoptosis related gene expression. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted allele exhibit a slight reduction in female fertility, normal body size, and normal serum phosphate and calcium levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A G 7: 40,993,461 T185A possibly damaging Het
4932414N04Rik A G 2: 68,731,109 Y260C possibly damaging Het
Adamtsl1 G A 4: 86,248,017 G395S probably damaging Het
Amn T C 12: 111,274,189 L85P probably benign Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Ap1s3 T C 1: 79,625,123 K56E probably damaging Het
Apeh G A 9: 108,092,679 H186Y probably damaging Het
Apip C T 2: 103,087,153 R66C possibly damaging Het
Apob C T 12: 8,007,769 R2084* probably null Het
Apol6 A T 15: 77,051,271 I247L probably benign Het
Arfgap2 A G 2: 91,267,195 Q112R probably benign Het
Armh1 A G 4: 117,231,782 Y139H probably damaging Het
Arntl2 A G 6: 146,821,946 Y258C probably damaging Het
Bag6 T C 17: 35,138,601 V122A probably damaging Het
Cacna1e T A 1: 154,425,932 T1685S probably benign Het
Cct2 C T 10: 117,056,159 G328D probably damaging Het
Cd163 T A 6: 124,317,991 C671* probably null Het
Cers5 G T 15: 99,772,219 A54E probably damaging Het
Ctdp1 T A 18: 80,459,240 M152L probably benign Het
Cul3 A G 1: 80,286,952 V211A probably damaging Het
Defb36 T A 2: 152,612,498 W26R probably damaging Het
Dnah17 T C 11: 118,034,310 E3899G probably damaging Het
Dnah6 A T 6: 73,065,815 I3208N probably damaging Het
Dnah7b T C 1: 46,325,886 F3609S probably damaging Het
Duox1 T G 2: 122,337,700 L1102R probably damaging Het
Dzip3 A G 16: 48,951,807 S500P probably damaging Het
Endod1 T C 9: 14,356,870 T440A probably benign Het
Exph5 A G 9: 53,373,946 T776A possibly damaging Het
Gabrg2 T C 11: 42,000,523 probably null Het
Hoxd3 A G 2: 74,744,076 Y22C probably damaging Het
Hspe1 T A 1: 55,090,701 probably null Het
Il6ra A G 3: 89,887,129 V175A probably damaging Het
Kat6a A G 8: 22,939,612 Q1661R unknown Het
Klhl18 T A 9: 110,436,062 N362I probably benign Het
March10 T C 11: 105,382,237 E692G probably damaging Het
Mars G A 10: 127,296,560 T856M probably benign Het
Mef2b C T 8: 70,167,119 T285I possibly damaging Het
Mmrn2 T C 14: 34,397,657 S198P probably benign Het
Nek5 T A 8: 22,107,721 M281L probably benign Het
Olfr1387 T A 11: 49,460,212 C178S probably damaging Het
Olfr596 A T 7: 103,310,429 H236L probably benign Het
Olfr676 G A 7: 105,035,671 V158M probably benign Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Pcdhgb5 T A 18: 37,732,699 F516I probably damaging Het
Pds5b T A 5: 150,723,248 N167K possibly damaging Het
Pepd G A 7: 34,969,543 R196H probably damaging Het
Pla2g4e A T 2: 120,182,738 M367K probably benign Het
Prdm4 A G 10: 85,910,221 probably null Het
Reln A G 5: 21,896,841 Y3364H probably damaging Het
Rufy4 T A 1: 74,133,224 S369T probably benign Het
Ryr2 T A 13: 11,680,999 H2994L probably damaging Het
Safb2 T C 17: 56,563,226 H950R possibly damaging Het
Serpina3k A T 12: 104,340,722 N71I probably damaging Het
Sez6 T C 11: 77,976,541 V788A possibly damaging Het
Skor1 A T 9: 63,145,314 W458R probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc19a2 C T 1: 164,256,775 T78M probably damaging Het
Slc8a3 T A 12: 81,314,978 I356F probably damaging Het
Smc4 T C 3: 69,027,891 V771A probably benign Het
Snapc4 A G 2: 26,378,551 S33P probably benign Het
Tcte1 T C 17: 45,533,289 S64P possibly damaging Het
Thsd7a G T 6: 12,471,104 S505* probably null Het
Tjp3 T A 10: 81,281,117 R193* probably null Het
Tm7sf2 A T 19: 6,067,200 W58R probably damaging Het
Top3a T C 11: 60,749,408 D488G probably benign Het
Ttc21a T C 9: 119,961,839 S884P possibly damaging Het
Usp17lb A G 7: 104,840,691 L342P probably damaging Het
Utrn T A 10: 12,501,476 Y2612F probably benign Het
Vwa3a A G 7: 120,782,400 N3S probably damaging Het
Zfp382 G A 7: 30,131,629 probably null Het
Zfp672 A T 11: 58,317,268 C76S probably damaging Het
Other mutations in Sfrp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Sfrp4 APN 13 19623630 missense possibly damaging 0.83
IGL03139:Sfrp4 APN 13 19623558 missense probably damaging 0.98
IGL03174:Sfrp4 APN 13 19632207 missense probably benign
P0043:Sfrp4 UTSW 13 19623595 missense probably benign 0.00
PIT4366001:Sfrp4 UTSW 13 19630244 missense unknown
R2021:Sfrp4 UTSW 13 19632326 missense probably benign 0.45
R4548:Sfrp4 UTSW 13 19623766 missense possibly damaging 0.88
R5723:Sfrp4 UTSW 13 19623698 missense probably damaging 1.00
R6279:Sfrp4 UTSW 13 19623853 missense probably damaging 1.00
R8544:Sfrp4 UTSW 13 19632166 splice site probably null
Predicted Primers PCR Primer
(F):5'- CTAGTGGACGTGAACTGCAG -3'
(R):5'- TGAGAGATAAACTTCTGGGCC -3'

Sequencing Primer
(F):5'- ACGTGAACTGCAGCTCTGTG -3'
(R):5'- GAGATAAACTTCTGGGCCCTTCAC -3'
Posted On2018-04-02