Incidental Mutation 'R6300:Tm7sf2'
ID509070
Institutional Source Beutler Lab
Gene Symbol Tm7sf2
Ensembl Gene ENSMUSG00000024799
Gene Nametransmembrane 7 superfamily member 2
Synonyms3110041O18Rik, ANG1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6300 (G1)
Quality Score218.009
Status Validated
Chromosome19
Chromosomal Location6062821-6077197 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 6067200 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 58 (W58R)
Ref Sequence ENSEMBL: ENSMUSP00000123989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025711] [ENSMUST00000025713] [ENSMUST00000113543] [ENSMUST00000159084] [ENSMUST00000159832] [ENSMUST00000160028] [ENSMUST00000160233] [ENSMUST00000161090] [ENSMUST00000161528] [ENSMUST00000161718] [ENSMUST00000162575] [ENSMUST00000162726] [ENSMUST00000162810]
Predicted Effect probably benign
Transcript: ENSMUST00000025711
SMART Domains Protein: ENSMUSP00000025711
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:COG2 56 191 2.6e-10 PFAM
Pfam:DUF2450 62 250 2.3e-14 PFAM
Pfam:Vps51 63 149 1.1e-26 PFAM
Pfam:Dor1 75 246 1.8e-19 PFAM
Pfam:Zw10 83 291 2.2e-8 PFAM
Pfam:Sec5 101 275 6.5e-24 PFAM
low complexity region 377 391 N/A INTRINSIC
low complexity region 523 532 N/A INTRINSIC
low complexity region 743 758 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000025713
AA Change: W58R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025713
Gene: ENSMUSG00000024799
AA Change: W58R

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 7 418 1.6e-141 PFAM
Pfam:DUF1295 250 409 9.4e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113543
AA Change: W58R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109171
Gene: ENSMUSG00000024799
AA Change: W58R

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 7 373 9.9e-112 PFAM
Pfam:DUF1295 249 396 2.6e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159084
AA Change: W58R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124868
Gene: ENSMUSG00000024799
AA Change: W58R

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 7 300 6.4e-75 PFAM
Pfam:ERG4_ERG24 292 391 2.2e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159211
Predicted Effect probably benign
Transcript: ENSMUST00000159475
Predicted Effect probably benign
Transcript: ENSMUST00000159832
SMART Domains Protein: ENSMUSP00000123994
Gene: ENSMUSG00000024797

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:COG2 56 191 2e-10 PFAM
Pfam:DUF2450 62 250 1.9e-14 PFAM
Pfam:Vps51 63 149 8.3e-27 PFAM
Pfam:Dor1 75 246 1.8e-19 PFAM
Pfam:Sec5 101 275 1.6e-19 PFAM
low complexity region 276 292 N/A INTRINSIC
low complexity region 377 391 N/A INTRINSIC
low complexity region 523 532 N/A INTRINSIC
low complexity region 743 758 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159869
Predicted Effect unknown
Transcript: ENSMUST00000160028
AA Change: W50R
SMART Domains Protein: ENSMUSP00000124847
Gene: ENSMUSG00000024799
AA Change: W50R

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160233
SMART Domains Protein: ENSMUSP00000124842
Gene: ENSMUSG00000024797

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160324
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160417
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160519
Predicted Effect probably damaging
Transcript: ENSMUST00000161090
AA Change: W58R

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125543
Gene: ENSMUSG00000024799
AA Change: W58R

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161222
Predicted Effect probably damaging
Transcript: ENSMUST00000161528
AA Change: W58R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123989
Gene: ENSMUSG00000024799
AA Change: W58R

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 7 109 5.3e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161634
Predicted Effect probably benign
Transcript: ENSMUST00000161718
SMART Domains Protein: ENSMUSP00000124283
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 1 197 5.7e-86 PFAM
Pfam:DUF1295 46 185 1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162549
Predicted Effect possibly damaging
Transcript: ENSMUST00000162575
AA Change: W58R

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125586
Gene: ENSMUSG00000024799
AA Change: W58R

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:ERG4_ERG24 51 229 5.5e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162721
Predicted Effect probably benign
Transcript: ENSMUST00000162726
SMART Domains Protein: ENSMUSP00000134031
Gene: ENSMUSG00000075227

DomainStartEndE-ValueType
Pfam:zf-HIT 3 36 2e-15 PFAM
low complexity region 54 97 N/A INTRINSIC
low complexity region 120 140 N/A INTRINSIC
low complexity region 167 205 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162810
SMART Domains Protein: ENSMUSP00000124825
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 9 124 6.9e-34 PFAM
Meta Mutation Damage Score 0.8816 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 99% (72/73)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit normal plasma cholesterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A G 7: 40,993,461 T185A possibly damaging Het
4932414N04Rik A G 2: 68,731,109 Y260C possibly damaging Het
Adamtsl1 G A 4: 86,248,017 G395S probably damaging Het
Amn T C 12: 111,274,189 L85P probably benign Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Ap1s3 T C 1: 79,625,123 K56E probably damaging Het
Apeh G A 9: 108,092,679 H186Y probably damaging Het
Apip C T 2: 103,087,153 R66C possibly damaging Het
Apob C T 12: 8,007,769 R2084* probably null Het
Apol6 A T 15: 77,051,271 I247L probably benign Het
Arfgap2 A G 2: 91,267,195 Q112R probably benign Het
Armh1 A G 4: 117,231,782 Y139H probably damaging Het
Arntl2 A G 6: 146,821,946 Y258C probably damaging Het
Bag6 T C 17: 35,138,601 V122A probably damaging Het
Cacna1e T A 1: 154,425,932 T1685S probably benign Het
Cct2 C T 10: 117,056,159 G328D probably damaging Het
Cd163 T A 6: 124,317,991 C671* probably null Het
Cers5 G T 15: 99,772,219 A54E probably damaging Het
Ctdp1 T A 18: 80,459,240 M152L probably benign Het
Cul3 A G 1: 80,286,952 V211A probably damaging Het
Defb36 T A 2: 152,612,498 W26R probably damaging Het
Dnah17 T C 11: 118,034,310 E3899G probably damaging Het
Dnah6 A T 6: 73,065,815 I3208N probably damaging Het
Dnah7b T C 1: 46,325,886 F3609S probably damaging Het
Duox1 T G 2: 122,337,700 L1102R probably damaging Het
Dzip3 A G 16: 48,951,807 S500P probably damaging Het
Endod1 T C 9: 14,356,870 T440A probably benign Het
Exph5 A G 9: 53,373,946 T776A possibly damaging Het
Gabrg2 T C 11: 42,000,523 probably null Het
Hoxd3 A G 2: 74,744,076 Y22C probably damaging Het
Hspe1 T A 1: 55,090,701 probably null Het
Il6ra A G 3: 89,887,129 V175A probably damaging Het
Kat6a A G 8: 22,939,612 Q1661R unknown Het
Klhl18 T A 9: 110,436,062 N362I probably benign Het
March10 T C 11: 105,382,237 E692G probably damaging Het
Mars G A 10: 127,296,560 T856M probably benign Het
Mef2b C T 8: 70,167,119 T285I possibly damaging Het
Mmrn2 T C 14: 34,397,657 S198P probably benign Het
Nek5 T A 8: 22,107,721 M281L probably benign Het
Olfr1387 T A 11: 49,460,212 C178S probably damaging Het
Olfr596 A T 7: 103,310,429 H236L probably benign Het
Olfr676 G A 7: 105,035,671 V158M probably benign Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Pcdhgb5 T A 18: 37,732,699 F516I probably damaging Het
Pds5b T A 5: 150,723,248 N167K possibly damaging Het
Pepd G A 7: 34,969,543 R196H probably damaging Het
Pla2g4e A T 2: 120,182,738 M367K probably benign Het
Prdm4 A G 10: 85,910,221 probably null Het
Reln A G 5: 21,896,841 Y3364H probably damaging Het
Rufy4 T A 1: 74,133,224 S369T probably benign Het
Ryr2 T A 13: 11,680,999 H2994L probably damaging Het
Safb2 T C 17: 56,563,226 H950R possibly damaging Het
Serpina3k A T 12: 104,340,722 N71I probably damaging Het
Sez6 T C 11: 77,976,541 V788A possibly damaging Het
Sfrp4 G A 13: 19,623,853 A141T probably damaging Het
Skor1 A T 9: 63,145,314 W458R probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc19a2 C T 1: 164,256,775 T78M probably damaging Het
Slc8a3 T A 12: 81,314,978 I356F probably damaging Het
Smc4 T C 3: 69,027,891 V771A probably benign Het
Snapc4 A G 2: 26,378,551 S33P probably benign Het
Tcte1 T C 17: 45,533,289 S64P possibly damaging Het
Thsd7a G T 6: 12,471,104 S505* probably null Het
Tjp3 T A 10: 81,281,117 R193* probably null Het
Top3a T C 11: 60,749,408 D488G probably benign Het
Ttc21a T C 9: 119,961,839 S884P possibly damaging Het
Usp17lb A G 7: 104,840,691 L342P probably damaging Het
Utrn T A 10: 12,501,476 Y2612F probably benign Het
Vwa3a A G 7: 120,782,400 N3S probably damaging Het
Zfp382 G A 7: 30,131,629 probably null Het
Zfp672 A T 11: 58,317,268 C76S probably damaging Het
Other mutations in Tm7sf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02292:Tm7sf2 APN 19 6063568 missense probably damaging 1.00
IGL03299:Tm7sf2 APN 19 6062928 missense probably benign 0.03
PIT4791001:Tm7sf2 UTSW 19 6063605 missense probably benign 0.00
R0033:Tm7sf2 UTSW 19 6066422 splice site probably benign
R0033:Tm7sf2 UTSW 19 6066422 splice site probably benign
R1607:Tm7sf2 UTSW 19 6063019 unclassified probably null
R3415:Tm7sf2 UTSW 19 6063599 missense probably damaging 1.00
R5392:Tm7sf2 UTSW 19 6063968 missense probably damaging 1.00
R5835:Tm7sf2 UTSW 19 6063884 missense probably damaging 1.00
R5886:Tm7sf2 UTSW 19 6066542 unclassified probably benign
R6065:Tm7sf2 UTSW 19 6063386 missense possibly damaging 0.65
R6915:Tm7sf2 UTSW 19 6068312 missense probably damaging 0.99
R7037:Tm7sf2 UTSW 19 6064077 critical splice donor site probably null
R7073:Tm7sf2 UTSW 19 6066497 critical splice donor site probably null
R7328:Tm7sf2 UTSW 19 6064126 missense possibly damaging 0.63
R7373:Tm7sf2 UTSW 19 6066646 missense probably benign 0.39
R7612:Tm7sf2 UTSW 19 6070608 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CATTAATAGGGTAGCGCAGGCG -3'
(R):5'- CTTGAGAGAGCTCTTGGGAG -3'

Sequencing Primer
(F):5'- AGGCGACTCTTGTCCTTCAG -3'
(R):5'- GAGCAGTCACGCTACACAGTG -3'
Posted On2018-04-02