Incidental Mutation 'R6696:Imp4'
ID528563
Institutional Source Beutler Lab
Gene Symbol Imp4
Ensembl Gene ENSMUSG00000026127
Gene NameIMP4, U3 small nucleolar ribonucleoprotein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R6696 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location34439851-34449356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34444246 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 247 (V247A)
Ref Sequence ENSEMBL: ENSMUSP00000027303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027303] [ENSMUST00000042493] [ENSMUST00000136770] [ENSMUST00000137794] [ENSMUST00000149962]
Predicted Effect probably benign
Transcript: ENSMUST00000027303
AA Change: V247A

PolyPhen 2 Score 0.436 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027303
Gene: ENSMUSG00000026127
AA Change: V247A

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Blast:Brix 22 71 3e-13 BLAST
Brix 86 258 2.37e-62 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000042493
SMART Domains Protein: ENSMUSP00000042918
Gene: ENSMUSG00000042111

DomainStartEndE-ValueType
coiled coil region 3 38 N/A INTRINSIC
coiled coil region 154 175 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128086
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134327
Predicted Effect probably benign
Transcript: ENSMUST00000136770
SMART Domains Protein: ENSMUSP00000120823
Gene: ENSMUSG00000026127

DomainStartEndE-ValueType
low complexity region 1 20 N/A INTRINSIC
Blast:Brix 25 70 3e-14 BLAST
Pfam:Brix 86 147 3.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137794
SMART Domains Protein: ENSMUSP00000121452
Gene: ENSMUSG00000026127

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Blast:Brix 26 91 4e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000149962
SMART Domains Protein: ENSMUSP00000141982
Gene: ENSMUSG00000026127

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Blast:Brix 26 91 4e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187077
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191315
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, along with IMP3 and MPP10, is part of the 60-80S U3 small nucleolar ribonucleoprotein (U3 snoRNP) complex. This complex is necessary for the early cleavage steps of pre-18S ribosomal RNA processing. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap25 G T 6: 87,465,651 H350Q probably damaging Het
Arhgap25 C A 6: 87,466,563 V305F probably damaging Het
Atg3 A T 16: 45,175,281 I126F possibly damaging Het
Best2 A T 8: 85,011,244 L174* probably null Het
Ccdc134 T A 15: 82,131,521 D67E probably damaging Het
Coasy G T 11: 101,083,101 R31L possibly damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Eipr1 C A 12: 28,859,358 T208N probably benign Het
Epha2 A G 4: 141,321,539 T606A probably benign Het
Fan1 A T 7: 64,350,078 I853N probably damaging Het
Fbxw18 A C 9: 109,688,764 S385A probably benign Het
Galnt11 T C 5: 25,255,114 V307A probably benign Het
Gata3 A T 2: 9,874,492 Y224* probably null Het
Gm4756 C T 12: 72,619,481 A139T possibly damaging Het
Gm527 T C 12: 64,921,092 M96T possibly damaging Het
Hivep2 T C 10: 14,133,759 F1720S probably benign Het
Hltf T G 3: 20,065,306 probably null Het
Iqca G A 1: 90,130,200 T259I probably benign Het
Klra6 A G 6: 130,016,733 F192L probably benign Het
Lnp1 T C 16: 56,927,786 K48E possibly damaging Het
Lrp4 A G 2: 91,497,345 D1513G probably benign Het
Lrrc25 G A 8: 70,618,365 probably null Het
Macf1 T A 4: 123,509,803 Y590F probably damaging Het
Mms19 C A 19: 41,954,013 V359L probably benign Het
Mns1 G A 9: 72,452,762 R398Q probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nme3 G T 17: 24,897,294 C158F possibly damaging Het
Pam T A 1: 97,885,727 H326L possibly damaging Het
Plcxd1 A G 5: 110,101,885 N151S possibly damaging Het
Prep A T 10: 45,153,078 N525Y probably damaging Het
Rab11fip5 T C 6: 85,341,946 I654V possibly damaging Het
Sbf2 T A 7: 110,560,298 Q35L probably benign Het
Shcbp1 A G 8: 4,739,262 F519S probably damaging Het
Slc18a3 T C 14: 32,464,313 I38V possibly damaging Het
Slc5a2 A T 7: 128,270,043 I332F probably damaging Het
Slc7a7 C T 14: 54,377,761 probably null Het
Srbd1 C T 17: 86,139,191 V47I possibly damaging Het
Synj1 C G 16: 90,960,452 V877L probably damaging Het
Tgfbr3 C T 5: 107,136,930 V618I probably benign Het
Tmem191c C T 16: 17,283,022 probably null Het
Tmem67 C A 4: 12,061,754 probably null Het
Tmem94 C T 11: 115,791,988 A617V probably damaging Het
Vmn1r71 T A 7: 10,748,474 I96F probably damaging Het
Vmn2r7 A T 3: 64,707,074 F440I probably benign Het
Wdr7 A G 18: 63,739,330 Q445R probably benign Het
Wnk1 A G 6: 119,948,282 L1407P probably damaging Het
Other mutations in Imp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01948:Imp4 APN 1 34444275 splice site probably benign
IGL02039:Imp4 APN 1 34443768 critical splice acceptor site probably null
IGL02483:Imp4 APN 1 34444275 splice site probably null
IGL02799:Imp4 UTSW 1 34440177 intron probably benign
R2265:Imp4 UTSW 1 34443847 missense probably damaging 1.00
R5038:Imp4 UTSW 1 34442935 missense probably damaging 1.00
R6034:Imp4 UTSW 1 34443456 missense probably damaging 1.00
R6034:Imp4 UTSW 1 34443456 missense probably damaging 1.00
R6145:Imp4 UTSW 1 34440096 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CTTTGCAAACCAGGATGACTAC -3'
(R):5'- ACTCAGGAAGACCCTCTTGC -3'

Sequencing Primer
(F):5'- ACCAGGATGACTACATTTCATTCCGG -3'
(R):5'- TGTAGGGGTGCCAGCGC -3'
Posted On2018-07-24