Incidental Mutation 'R6696:Mns1'
ID528589
Institutional Source Beutler Lab
Gene Symbol Mns1
Ensembl Gene ENSMUSG00000032221
Gene Namemeiosis-specific nuclear structural protein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R6696 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location72438011-72462025 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 72452762 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 398 (R398Q)
Ref Sequence ENSEMBL: ENSMUSP00000034746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034746] [ENSMUST00000183809] [ENSMUST00000184312] [ENSMUST00000184604]
Predicted Effect probably damaging
Transcript: ENSMUST00000034746
AA Change: R398Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034746
Gene: ENSMUSG00000032221
AA Change: R398Q

DomainStartEndE-ValueType
Pfam:TPH 117 462 3.1e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183809
SMART Domains Protein: ENSMUSP00000139105
Gene: ENSMUSG00000032221

DomainStartEndE-ValueType
Pfam:Trichoplein 116 219 5.1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184312
SMART Domains Protein: ENSMUSP00000138844
Gene: ENSMUSG00000090626

DomainStartEndE-ValueType
coiled coil region 23 63 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184604
SMART Domains Protein: ENSMUSP00000139232
Gene: ENSMUSG00000032221

DomainStartEndE-ValueType
Pfam:Trichoplein 116 158 8e-12 PFAM
Pfam:Trichoplein 150 206 1.4e-9 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein highly similar to the mouse meiosis-specific nuclear structural 1 protein. The mouse protein was shown to be expressed at the pachytene stage during spermatogenesis and may function as a nuclear skeletal protein to regulate nuclear morphology during meiosis. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null mutation display partial lethality, male infertility, sperm flagellum abnormalities, immotile sperm, randomized left-right patterning, hydroencephaly, and motile cilia abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap25 G T 6: 87,465,651 H350Q probably damaging Het
Arhgap25 C A 6: 87,466,563 V305F probably damaging Het
Atg3 A T 16: 45,175,281 I126F possibly damaging Het
Best2 A T 8: 85,011,244 L174* probably null Het
Ccdc134 T A 15: 82,131,521 D67E probably damaging Het
Coasy G T 11: 101,083,101 R31L possibly damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Eipr1 C A 12: 28,859,358 T208N probably benign Het
Epha2 A G 4: 141,321,539 T606A probably benign Het
Fan1 A T 7: 64,350,078 I853N probably damaging Het
Fbxw18 A C 9: 109,688,764 S385A probably benign Het
Galnt11 T C 5: 25,255,114 V307A probably benign Het
Gata3 A T 2: 9,874,492 Y224* probably null Het
Gm4756 C T 12: 72,619,481 A139T possibly damaging Het
Gm527 T C 12: 64,921,092 M96T possibly damaging Het
Hivep2 T C 10: 14,133,759 F1720S probably benign Het
Hltf T G 3: 20,065,306 probably null Het
Imp4 T C 1: 34,444,246 V247A probably benign Het
Iqca G A 1: 90,130,200 T259I probably benign Het
Klra6 A G 6: 130,016,733 F192L probably benign Het
Lnp1 T C 16: 56,927,786 K48E possibly damaging Het
Lrp4 A G 2: 91,497,345 D1513G probably benign Het
Lrrc25 G A 8: 70,618,365 probably null Het
Macf1 T A 4: 123,509,803 Y590F probably damaging Het
Mms19 C A 19: 41,954,013 V359L probably benign Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nme3 G T 17: 24,897,294 C158F possibly damaging Het
Pam T A 1: 97,885,727 H326L possibly damaging Het
Plcxd1 A G 5: 110,101,885 N151S possibly damaging Het
Prep A T 10: 45,153,078 N525Y probably damaging Het
Rab11fip5 T C 6: 85,341,946 I654V possibly damaging Het
Sbf2 T A 7: 110,560,298 Q35L probably benign Het
Shcbp1 A G 8: 4,739,262 F519S probably damaging Het
Slc18a3 T C 14: 32,464,313 I38V possibly damaging Het
Slc5a2 A T 7: 128,270,043 I332F probably damaging Het
Slc7a7 C T 14: 54,377,761 probably null Het
Srbd1 C T 17: 86,139,191 V47I possibly damaging Het
Synj1 C G 16: 90,960,452 V877L probably damaging Het
Tgfbr3 C T 5: 107,136,930 V618I probably benign Het
Tmem191c C T 16: 17,283,022 probably null Het
Tmem67 C A 4: 12,061,754 probably null Het
Tmem94 C T 11: 115,791,988 A617V probably damaging Het
Vmn1r71 T A 7: 10,748,474 I96F probably damaging Het
Vmn2r7 A T 3: 64,707,074 F440I probably benign Het
Wdr7 A G 18: 63,739,330 Q445R probably benign Het
Wnk1 A G 6: 119,948,282 L1407P probably damaging Het
Other mutations in Mns1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Mns1 APN 9 72456913 unclassified probably benign
R0390:Mns1 UTSW 9 72452804 missense probably damaging 1.00
R0512:Mns1 UTSW 9 72449471 missense possibly damaging 0.87
R1803:Mns1 UTSW 9 72452734 missense probably damaging 1.00
R1988:Mns1 UTSW 9 72448759 unclassified probably null
R3821:Mns1 UTSW 9 72439448 missense probably damaging 1.00
R3822:Mns1 UTSW 9 72439448 missense probably damaging 1.00
R4640:Mns1 UTSW 9 72439282 missense probably benign 0.36
R6051:Mns1 UTSW 9 72449453 missense probably damaging 1.00
R6835:Mns1 UTSW 9 72452744 missense probably damaging 1.00
R7257:Mns1 UTSW 9 72452815 missense probably damaging 1.00
R7340:Mns1 UTSW 9 72448743 missense probably damaging 1.00
R7903:Mns1 UTSW 9 72452811 missense probably benign 0.04
R7986:Mns1 UTSW 9 72452811 missense probably benign 0.04
R8068:Mns1 UTSW 9 72448527 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACGTAACTCTAGCCCCACTG -3'
(R):5'- TACACACTAGGGTGCACATG -3'

Sequencing Primer
(F):5'- GTAACTCTAGCCCCACTGTCGTG -3'
(R):5'- ATGTGCACACTCAAGCTCTC -3'
Posted On2018-07-24