Incidental Mutation 'R7778:Ldlrad4'
ID599037
Institutional Source Beutler Lab
Gene Symbol Ldlrad4
Ensembl Gene ENSMUSG00000024544
Gene Namelow density lipoprotein receptor class A domain containing 4
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock #R7778 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location67933257-68255549 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 68235669 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 66 (A66S)
Ref Sequence ENSEMBL: ENSMUSP00000068471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063775]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063775
AA Change: A66S

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000068471
Gene: ENSMUSG00000024544
AA Change: A66S

DomainStartEndE-ValueType
LDLa 14 49 3.69e-8 SMART
transmembrane domain 65 87 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,739,511 S524P possibly damaging Het
Asb5 A C 8: 54,584,792 H173P Het
Atp6v0a2 A G 5: 124,641,505 E186G probably damaging Het
Bbs2 A T 8: 94,089,760 probably null Het
Chrm5 A G 2: 112,479,956 S272P probably benign Het
Chrna6 T C 8: 27,407,364 I162V probably damaging Het
Cldn6 T A 17: 23,681,607 C182S probably damaging Het
Cysltr2 A G 14: 73,029,763 I169T probably benign Het
Ddx11 T C 17: 66,130,548 probably null Het
Efhc1 A T 1: 20,979,461 Y515F probably damaging Het
Elmo1 A G 13: 20,589,642 probably null Het
Ep300 T C 15: 81,586,686 S20P unknown Het
Gfpt2 T G 11: 49,824,441 I421R probably damaging Het
Gm14226 T A 2: 155,024,710 C196S possibly damaging Het
Grm8 T C 6: 27,363,672 R615G possibly damaging Het
Hic1 C T 11: 75,166,216 V616M possibly damaging Het
Ing1 A G 8: 11,561,814 E178G probably benign Het
Kansl3 A T 1: 36,348,677 L530H probably damaging Het
Kcna5 A T 6: 126,534,805 L120* probably null Het
Kcnt1 T G 2: 25,901,889 I617S probably benign Het
Lama1 T A 17: 67,804,473 S2240T Het
Lcn2 T C 2: 32,387,915 D55G probably benign Het
Matn2 A T 15: 34,399,077 H370L possibly damaging Het
Mettl23 T G 11: 116,849,270 V189G probably benign Het
Mpp4 G A 1: 59,123,513 T543M not run Het
Odf4 A T 11: 68,922,072 S253R probably benign Het
Olfr39 A G 9: 20,282,412 probably benign Het
Olfr748 G T 14: 50,710,471 C47F possibly damaging Het
Olfr883 T A 9: 38,026,667 I287N probably damaging Het
Olfr935 T A 9: 38,994,907 H176L probably damaging Het
Olfr963 C A 9: 39,669,238 F60L possibly damaging Het
Pcdha11 A T 18: 37,012,680 Y608F possibly damaging Het
Pcdhga5 A G 18: 37,695,525 D342G probably damaging Het
Pde6d A G 1: 86,543,528 S143P probably damaging Het
Plec A T 15: 76,176,935 I2934N probably damaging Het
Primpol G T 8: 46,586,424 P387Q probably damaging Het
Prkcd C T 14: 30,605,815 probably null Het
Prph2 T C 17: 46,910,806 L37S possibly damaging Het
Prrt4 A G 6: 29,177,719 L17P probably damaging Het
Pycrl T C 15: 75,918,289 D171G probably damaging Het
Rapsn A G 2: 91,044,948 T359A probably benign Het
Setd6 A T 8: 95,716,238 H101L probably benign Het
Sez6 T C 11: 77,974,549 S671P probably damaging Het
Son T C 16: 91,656,528 L721S probably damaging Het
Spata31d1b A T 13: 59,717,233 R732W possibly damaging Het
Srd5a3 T A 5: 76,154,771 F328I probably damaging Het
Tfap2b G A 1: 19,234,307 G447D probably damaging Het
Thoc3 A C 13: 54,463,778 F232C probably damaging Het
Tmem69 A G 4: 116,553,398 L125P probably damaging Het
Tnfsf13 C T 11: 69,685,163 V33M probably damaging Het
Togaram2 T A 17: 71,704,751 M476K probably benign Het
Tube1 A G 10: 39,142,298 I124V probably benign Het
Uevld A T 7: 46,926,352 I462N probably damaging Het
Utrn G A 10: 12,486,610 R2660C probably damaging Het
Vcan T C 13: 89,688,654 T2924A probably damaging Het
Vmn2r120 T C 17: 57,525,942 Y79C probably damaging Het
Vwa8 T C 14: 79,038,147 V790A probably benign Het
Zfp874b A G 13: 67,473,974 F402L probably benign Het
Zfp936 A G 7: 43,190,296 T396A possibly damaging Het
Zfp978 T C 4: 147,385,303 probably null Het
Other mutations in Ldlrad4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02939:Ldlrad4 APN 18 68254514 missense probably damaging 1.00
IGL03140:Ldlrad4 APN 18 68254514 missense probably damaging 1.00
R1566:Ldlrad4 UTSW 18 68250598 missense probably benign
R1750:Ldlrad4 UTSW 18 68106687 missense probably benign 0.11
R6347:Ldlrad4 UTSW 18 68235780 missense probably benign 0.00
R7774:Ldlrad4 UTSW 18 68235792 nonsense probably null
R7775:Ldlrad4 UTSW 18 68235669 missense possibly damaging 0.50
R7775:Ldlrad4 UTSW 18 68235756 missense probably damaging 1.00
R7777:Ldlrad4 UTSW 18 68235669 missense possibly damaging 0.50
R7812:Ldlrad4 UTSW 18 68106671 missense probably benign 0.07
R7827:Ldlrad4 UTSW 18 68254424 missense probably damaging 0.97
R8018:Ldlrad4 UTSW 18 68235669 missense possibly damaging 0.50
R8019:Ldlrad4 UTSW 18 68235669 missense possibly damaging 0.50
R8020:Ldlrad4 UTSW 18 68235669 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- CCATGCAGCCGTTTTATGACTG -3'
(R):5'- AGTGGGCTATCCTACCCTCTAG -3'

Sequencing Primer
(F):5'- GCAGCCGTTTTATGACTGCATTTTC -3'
(R):5'- TGCCACACCCTGTCTGG -3'
Posted On2019-11-26