Incidental Mutation 'R0693:Gbgt1'
ID63391
Institutional Source Beutler Lab
Gene Symbol Gbgt1
Ensembl Gene ENSMUSG00000026829
Gene Namegloboside alpha-1,3-N-acetylgalactosaminyltransferase 1
Synonyms
MMRRC Submission 038878-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0693 (G1)
Quality Score85
Status Not validated
Chromosome2
Chromosomal Location28496891-28505415 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 28504830 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 160 (G160D)
Ref Sequence ENSEMBL: ENSMUSP00000127071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028172] [ENSMUST00000074761] [ENSMUST00000163121]
Predicted Effect probably damaging
Transcript: ENSMUST00000028172
AA Change: G160D

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028172
Gene: ENSMUSG00000026829
AA Change: G160D

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
Pfam:Glyco_transf_6 33 347 1.6e-154 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074761
SMART Domains Protein: ENSMUSP00000082978
Gene: ENSMUSG00000063611

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127958
Predicted Effect probably damaging
Transcript: ENSMUST00000163121
AA Change: G160D

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127071
Gene: ENSMUSG00000026829
AA Change: G160D

DomainStartEndE-ValueType
Pfam:Glyco_transf_6 11 347 1.9e-152 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosyltransferase that plays a role in the synthesis of Forssman glycolipid (FG), a member of the globoseries glycolipid family. Glycolipids such as FG form attachment sites for the binding of pathogens to cells; expression of this protein may determine host tropism to microorganisms. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef12 A T 9: 43,018,401 N199K probably damaging Het
Ccnj T A 19: 40,837,107 L87H probably damaging Het
Cntn3 T C 6: 102,168,947 T978A possibly damaging Het
Garnl3 A G 2: 33,085,907 F16L probably damaging Het
Gm5114 T C 7: 39,408,764 D477G probably benign Het
Gp1ba T C 11: 70,640,458 probably benign Het
Inpp4b A T 8: 81,997,314 T492S probably benign Het
Islr2 T C 9: 58,199,744 T78A possibly damaging Het
Klhl9 T G 4: 88,720,290 K571N probably benign Het
Msl3l2 G A 10: 56,115,851 R224Q possibly damaging Het
Nfe2l3 A G 6: 51,433,054 T50A possibly damaging Het
Olfr850 G A 9: 19,477,972 Q90* probably null Het
Olfr889 A G 9: 38,116,029 T78A probably benign Het
Prkg1 T A 19: 30,594,978 Q426L probably benign Het
Rnf215 G A 11: 4,140,401 probably null Het
Sp100 T A 1: 85,667,005 probably null Het
Tbc1d21 G A 9: 58,361,287 T263M probably damaging Het
Tenm2 G A 11: 36,024,809 T1966M probably damaging Het
Tnni3k T C 3: 154,961,972 Y268C probably damaging Het
Usp34 A G 11: 23,452,637 T2477A probably damaging Het
Other mutations in Gbgt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Gbgt1 APN 2 28502195 critical splice acceptor site probably null
IGL01586:Gbgt1 APN 2 28497830 missense probably benign 0.00
R0031:Gbgt1 UTSW 2 28498450 splice site probably benign
R1623:Gbgt1 UTSW 2 28504976 missense probably benign 0.38
R1739:Gbgt1 UTSW 2 28505052 missense possibly damaging 0.55
R2221:Gbgt1 UTSW 2 28498423 missense probably damaging 1.00
R4418:Gbgt1 UTSW 2 28498408 missense probably damaging 1.00
R4674:Gbgt1 UTSW 2 28498441 missense possibly damaging 0.87
R4675:Gbgt1 UTSW 2 28498441 missense possibly damaging 0.87
R4926:Gbgt1 UTSW 2 28503170 missense probably damaging 0.99
R5254:Gbgt1 UTSW 2 28505208 missense probably damaging 1.00
R5341:Gbgt1 UTSW 2 28505007 missense probably damaging 1.00
R5399:Gbgt1 UTSW 2 28503218 missense probably damaging 1.00
R6562:Gbgt1 UTSW 2 28504886 missense probably damaging 0.99
R6658:Gbgt1 UTSW 2 28504986 missense probably benign 0.00
R6830:Gbgt1 UTSW 2 28505208 missense probably damaging 1.00
R7466:Gbgt1 UTSW 2 28502207 missense probably damaging 0.96
R7636:Gbgt1 UTSW 2 28505314 missense probably damaging 1.00
R7839:Gbgt1 UTSW 2 28503170 missense probably damaging 0.99
R7922:Gbgt1 UTSW 2 28503170 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAGACTTCAGCGCATACTGGGGAC -3'
(R):5'- TTCCGGCGAGGTACAGCAAAATAG -3'

Sequencing Primer
(F):5'- CCAGGTACACCTGCTTCATTCA -3'
(R):5'- TGAATGGCAGCCACTAGATCC -3'
Posted On2013-07-30